<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article
  PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD with OASIS Tables with MathML3 v1.1 20151215//EN" "JATS-journalpublishing-oasis-article1-mathml3.dtd">
<article xmlns:xlink="http://www.w3.org/1999/xlink" xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xmlns:ali="http://www.niso.org/schemas/ali/1.0/" xmlns:oasis="http://www.niso.org/standards/z39-96/ns/oasis-exchange/table" article-type="research-article" xml:lang="en" dtd-version="1.1">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">GRAELL</journal-id>
      <journal-title-group>
        <journal-title xml:lang="en">Graellsia</journal-title>
        <abbrev-journal-title abbrev-type="publisher">Graellsia</abbrev-journal-title>
      </journal-title-group>
      <issn publication-format="print">0367-5041</issn>
      <issn publication-format="electronic">1989-953X</issn>
      <issn-l>0367-5041</issn-l>
      <publisher>
        <publisher-name>Consejo Superior de Investigaciones Cient&#237;ficas</publisher-name>
        <publisher-name>SAM</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.3989/graellsia.2023.v79.347</article-id>
      <article-id pub-id-type="publisher-id">graellsia.2023.v79.347</article-id>
      <article-categories>
        <subj-group subj-group-type="heading">
          <subject>Article / <italic>Art&#237;culo</italic>
          </subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>HABITAT, AGGREGATIONS AND POSTEMBRYONIC DEVELOPMENT OF THE SIPHONOCRYPTID MILLIPEDE <italic>HIRUDICRYPTUS CANARIENSIS </italic>(LOKSA, 1967) IN&#160;THE LAUREL FOREST OF TENERIFE (DIPLOPODA: SIPHONOCRYPTIDA)</article-title>
        <trans-title-group xml:lang="es">
          <trans-title>H&#225;bitat, agregaciones y desarrollo postembrionario del milpi&#233;s <italic> Hirudicryptus canariensis </italic>(Loksa, 1967) en el bosque de laurisilva de Tenerife (Diplopoda: Siphonocryptida)</trans-title>
        </trans-title-group>
        <alt-title alt-title-type="running-head">HABITAT, AGGREGATIONS AND POSTEMBRYONIC DEVELOPMENT OF THE SIPHONOCRYPTID MILLIPEDE <italic>HIRUDICRYPTUS CANARIENSIS </italic></alt-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author" id="ra1">
          <contrib-id contrib-id-type="orcid" authenticated="false">https://orcid.org/0000-0002-6028-5189</contrib-id>
          <name name-style="western">
            <surname>Moritz</surname>
            <given-names>Leif</given-names>
          </name>
          <xref ref-type="aff" rid="aff1"/>
          <xref ref-type="corresp" rid="cor2"/>
          <aff id="aff1">
            <label>[1]</label>
            <institution>Zoologisches Forschungsmuseum Alexander Koenig, Leibniz Institute for the Study of Biodiversity Change (LIB)</institution>, <addr-line>Adenauerallee 160, 53113 Bonn</addr-line>, <country>Germany</country>. <institution>Institute of Evolutionary Biology and Ecology, University of Bonn</institution>, <addr-line>An der Immenburg 1, 53121 Bonn</addr-line>, <country>Germany</country>. </aff>
          <email>moritz.leif@gmail.com</email>
        </contrib>
        <contrib contrib-type="author" id="ra2">
          <contrib-id contrib-id-type="orcid" authenticated="false">https://orcid.org/0000-0002-2028-3541</contrib-id>
          <name name-style="western">
            <surname>Wesener</surname>
            <given-names>Thomas</given-names>
          </name>
          <xref ref-type="aff" rid="aff2"/>
          <aff id="aff2">
            <label>[2]</label>
            <institution>Zoologisches Forschungsmuseum Alexander Koenig, Leibniz Institute for the Study of Biodiversity Change (LIB)</institution>, <addr-line>Adenauerallee 160, 53113 Bonn</addr-line>, <country>Germany</country>. </aff>
          <email>t.wesener@leibniz-lib.de</email>
        </contrib>
        <contrib contrib-type="author" id="ra3">
          <contrib-id contrib-id-type="orcid" authenticated="false">https://orcid.org/0000-0002-2367-6789</contrib-id>
          <name name-style="western">
            <surname>Wipfler</surname>
            <given-names>Benjamin</given-names>
          </name>
          <xref ref-type="aff" rid="aff3"/>
          <aff id="aff3">
            <label>[3]</label>
            <institution>Zoologisches Forschungsmuseum Alexander Koenig, Leibniz Institute for the Study of Biodiversity Change (LIB)</institution>, <addr-line>Adenauerallee 160, 53113 Bonn</addr-line>, <country>Germany</country>. </aff>
          <email>Benjamin.Wipfler@leibniz-lib.de</email>
        </contrib>
      </contrib-group>
      <author-notes>
        <corresp id="cor2"><label>*</label>Correspondig autor: <email>moritz.leif@gmail.com</email>
        </corresp>
      </author-notes>
      <pub-date pub-type="epub">
        <day>00</day>
        <month>02</month>
        <year>2023</year>
      </pub-date>
      <pub-date pub-type="collection">
        <month>6</month>
        <year>2023</year>
      </pub-date>
      <volume>79</volume>
      <issue>1</issue>
      <elocation-id>e180</elocation-id>
      <history>
        <date date-type="received">
          <day>14</day>
          <month>03</month>
          <year>2022</year>
        </date>
        <date date-type="accepted">
          <day>14</day>
          <month>09</month>
          <year>2022</year>
        </date>
        <date date-type="available-online">
          <day>16</day>
          <month>05</month>
          <year>2023</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>&#169; 2023 SAM &amp; CSIC</copyright-statement>
        <copyright-year>2023</copyright-year>
        <license license-type="open-access" xlink:href="https://creativecommons.org/licenses/by/4.0/">
          <license-p>This is an open-access article distributed under the terms of the Creative Commons Attribution 4.0 International (CC BY 4.0) License.</license-p>
        </license>
      </permissions>
      <self-uri xlink:href="GRAELL-XX-X-eXXX.pdf"/>
      <abstract xml:lang="en">
        <p>Millipedes (Diplopoda) are detritivores, which mostly live hidden within the soil and leaf litter, and for most species only little is known about their biology. This is especially true for the enigmatic Colobognatha, such as <italic>Hirudicryptus canariensis, </italic>a siphonocryptid millipede which is endemic to the laurel forests of Macaronesia. So far, no one reported observations of a living Siphonocryptida. Here we present observations of living specimens in the Anaga Mountains on Tenerife, Canary Islands (Spain) as well as data on their postembryonic development based on observations of 296 specimens, including data from the literature. On Tenerife <italic>Hirudicryptus canariensis </italic>was exclusively found on and under the bark of the heather <italic>Erica platycodon </italic>at elevations of 630&#8211;870 m. <italic>Hirudicryptus canariensis </italic>formed aggregations of juvenile and mature individuals with several hundred individuals per tree and can be considered as &#8216;transient subsocial&#8217;. <italic>Hirudicryptus canariensis </italic>hatches with 6 tergites and 7 leg pairs (stadium I), lacking an apodous tergite, and subsequent stadia always have a single apparently apodous tergite, although a varying number of podous tergites is added. Therefore, podous tergites can develop de novo without an apodous precursor. The number of leg pairs is always odd, and immature gonopods (modifications of leg 9 and 10 in males) occur first in individuals of stadium IIIwith 15 tergites and 23 leg pairs. Gonopods are fully developed in stadium IV. The postembryonic development is partly reflected in the color pattern. For future identification of <italic>H. canariensis, </italic>we provide first barcode data (CO1) of the species and the first molecular data of a member of the Siphonocryptida.</p>
      </abstract>
      <trans-abstract xml:lang="es">
        <p>Los milpi&#233;s (Diplopoda) son detrit&#237;voros que viven generalmente ocultos dentro del suelo y la hojarasca, y en la mayor&#237;a de las especies poco se conoce sobre su biolog&#237;a. Esto es especialmente cierto en el caso de los enigm&#225;ticos Colobognatha, como <italic>Hirudicryptus canariensis, </italic>un milpi&#233;s sifon&#243;criptido end&#233;mico de los bosques de laurisilva de la Macaronesia. Hasta ahora, nadie ha reportado observaciones de un Siphonocryptida vivo. Aqu&#237; presentamos observaciones de ejemplares vivos en el macizo de Anaga en Tenerife, Islas Canarias (Espa&#241;a), as&#237; como tambi&#233;n datos sobre su desarrollo postembrionario basados en observaciones de 296 ejemplares, incluyendo datos de la literatura. En Tenerife <italic>Hirudicryptus canariensis </italic>se encontr&#243; exclusivamente sobre y bajo la corteza del brezo <italic>Erica platycodon </italic>a elevaciones de 630-870 m. <italic>Hirudicryptus canariensis </italic>forma agregaciones de individuos juveniles y maduros con varios cientos de ejemplares por &#225;rbol y puede considerarse como &#8216;temporalmente subsocial. <italic>H. canariensis </italic>eclosiona con 6 terguitos y 7 pares de patas (estadio I), careciendo de un terguito &#225;podo, y en los estadios posteriores siempre tiene un &#250;nico terguito aparentemente &#225;podo, aunque se a&#241;ade un n&#250;mero variable de terguitos con patas. Por lo tanto, estos &#250;ltimos pueden desarrollarse de nuevo sin un precursor &#225;podo. El n&#250;mero de pares de patas es siempre impar, y los gon&#243;podos inmaduros(modificaciones de los pares de patas 9 y 10 en los machos) aparecen inicialmente en individuos del estadio III con 15 terguitos y 23 pares de patas. Los gon&#243;podos est&#225;n completamente desarrollados en el estadio IV. El desarrollo postembrionario se refleja en parte en el patr&#243;n de color. Para futuras identificaciones de <italic>H.&#160;canariensis, </italic>proporcionamos los primeros datos de la secuencia gen&#233;tica (CO1) de la especie y los primeros datos moleculares de un miembro de los Siphonocryptida.</p>
      </trans-abstract>
      <kwd-group xml:lang="en">
        <kwd>Anaga Mountains</kwd>
        <kwd>Canary Islands</kwd>
        <kwd>endemism</kwd>
        <kwd><italic>Erica platycodon</italic></kwd>
        <kwd>Macaronesia</kwd>
        <kwd>social</kwd>
      </kwd-group>
      <kwd-group xml:lang="es">
        <kwd>endemismo</kwd>
        <kwd><italic>Erica platycodon</italic></kwd>
        <kwd>Islas Canarias</kwd>
        <kwd>Macaronesia</kwd>
        <kwd>Macizo de Anaga</kwd>
        <kwd>social</kwd>
      </kwd-group>
      <counts>
        <page-count count="19"/>
      </counts>
      <custom-meta-group>
        <custom-meta>
          <meta-name>xml-html-producer</meta-name>
          <meta-value>Composiciones RALI, S.A.</meta-value>
        </custom-meta>
        <custom-meta id="how-to-cite">
          <meta-name>C&#243;mo citar este art&#237;culo/Citation: </meta-name>
          <meta-value>Moritz, L., Wesener. T. &amp; Wipfler, B. 2023. Habitat, aggregations and postembryonic development of the siphonocryptid millipede <italic>Hirudicryptus canariensis </italic>(<xref ref-type="bibr" rid="ref56">Loksa, 1967</xref>) in the laurel forest of Tenerife (Diplopoda: Siphonocryptida). <italic>Graellsia, </italic>79(1): e180. <ext-link xlink:href="https://doi.org/10.3989/graellsia.2023.v79.347" ext-link-type="uri">https://doi.org/10.3989/graellsia.2023.v79.347</ext-link></meta-value>
        </custom-meta>
      </custom-meta-group>
    </article-meta>
  </front>
  <body>
    <sec id="sec1">
      <title>Introduction</title>
      <p>Millipedes (Diplopoda) play a fundamental role in terrestrial ecosystems as detritivores and soil forming organisms (<xref rid="ref41" ref-type="bibr">Golovatch &amp; Kime, 2009</xref>; <xref ref-type="bibr" rid="ref48">Joly <italic>et al., </italic>2020</xref>), and are often adapted to certain microclimates, and biotic and abiotic factors (<xref rid="ref16" ref-type="bibr">David, 2015</xref>). For example, the hygrophilous colobognathan millipedes, which contain the millipede species with the highest number of legs (<xref ref-type="bibr" rid="ref60">Marek <italic>et al. </italic>2021</xref>), are often found in moist habitats and are vulnerable to desiccation (e.g. <xref rid="ref14" ref-type="bibr">Cook &amp; Loomis, 1928</xref>; <xref rid="ref96" ref-type="bibr">Wegensteiner, 1982</xref>; <xref ref-type="bibr" rid="ref40">Golovatch <italic>et al., </italic>2015</xref>). The Colobognatha comprise the four taxa Platydesmida, Siphonophorida, Polyzoniida and Siphonocryptida (<xref rid="ref9" ref-type="bibr">Blanke &amp; Wesener, 2014</xref>), and are probably one of the least studied and most neglected millipede groups with regard to their taxonomy (<xref ref-type="bibr" rid="ref11">Brewer <italic>et al., </italic>2012</xref>; <xref rid="ref76" ref-type="bibr">Read &amp; Enghoff, 2018</xref>), biology and morphology (<xref rid="ref59" ref-type="bibr">Manton, 1961</xref>; <xref rid="ref47" ref-type="bibr">Hoffman, 1980</xref>; <xref rid="ref75" ref-type="bibr">Read &amp;
        Enghoff, 2009</xref>; <xref ref-type="bibr" rid="ref86">Shorter <italic>et al., </italic>2018</xref>). They share highly derived mouthparts, which are siphon-like in some groups (<xref rid="ref59" ref-type="bibr">Manton, 1961</xref>) and used to feed on liquid food (<xref ref-type="bibr" rid="ref65">Moritz <italic>et al., </italic>2021</xref>, <xref ref-type="bibr" rid="ref66">2022</xref>). Colobognatha might feed on fungi, algae, or bacterially degraded substances (<xref rid="ref54" ref-type="bibr">Lewis, 1984</xref>; <xref rid="ref20" ref-type="bibr">Dunger, 1993</xref>; <xref ref-type="bibr" rid="ref58">Macias <italic>et al., </italic>2019</xref>). The biology of this group is largely unknown, and observations of living animals are rare, as many species have not been collected nor observed since their initial discovery. However, some colobognathan species are reported to exhibit subsocial or colonial behavior like brood care, even male brood care, and the formation of aggregations with individuals of overlapping generations (e.g. <xref rid="ref67" ref-type="bibr">Murakami, 1962a</xref>; <xref rid="ref37" ref-type="bibr">Gardner, 1974</xref>; <xref rid="ref22" ref-type="bibr">Enghoff, 1984</xref>; <xref rid="ref54" ref-type="bibr">Lewis, 1984</xref>; <xref ref-type="bibr" rid="ref98">Wong <italic>et al., </italic>2020</xref>). Only few studies focus on the postembryonic development of Colobognatha (<xref rid="ref67" ref-type="bibr">Murakami 1962a</xref>, <xref ref-type="bibr" rid="ref68">1962b</xref>, <xref ref-type="bibr" rid="ref69">1963</xref>; <xref rid="ref17" ref-type="bibr">David
          &amp; Couret, 1983</xref>; <xref ref-type="bibr" rid="ref27">Enghoff <italic>et al., </italic>1993</xref>; <xref ref-type="bibr" rid="ref98">Wong <italic>et al., </italic>2020</xref>), but available data suggest that the Colobognatha differ from most other Diplopoda by hatching with more than three leg pairs (<xref ref-type="bibr" rid="ref27">Enghoff <italic>et al., </italic>1993</xref>; <xref rid="ref9" ref-type="bibr">Blanke &amp; Wesener, 2014</xref>). Postembryonic stadia in millipedes extend between two molts (<xref ref-type="bibr" rid="ref27">Enghoff <italic>et al., </italic>1993</xref>; <xref rid="ref63" ref-type="bibr">Minelli, 2015</xref>), and in rare cases the color pattern of a millipede can reflect the course of anamorphosis; i.e. the number of tergites added between subsequent stadia (<xref rid="ref26" ref-type="bibr">Enghoff, 2011</xref>). Studies on the anamorphosis (the addition of segments and legs) of millipedes do not only give an insight into their biology but also allow conclusions concerning the evolution and phylogeny of millipedes (<xref ref-type="bibr" rid="ref27">Enghoff <italic>et al., </italic>1993</xref>).</p>
      <p>Siphonocryptid millipedes are considered to represent an independent order (<xref rid="ref85" ref-type="bibr">Shelley, 2003</xref>), but were previously treated as a family or suborder of the Polyzoniida (e.g. <xref rid="ref46" ref-type="bibr">Hoffman, 1977</xref>; <xref rid="ref29" ref-type="bibr">Enghoff &amp; Golovatch, 1995</xref>; <xref ref-type="bibr" rid="ref4">Arndt <italic>et al., </italic>2008</xref>). The group comprises 7 known species (<xref ref-type="bibr" rid="ref31">Enghoff <italic>et al., </italic>2015</xref>) in two genera (<italic>Hirudicryptus </italic><xref rid="ref29" ref-type="bibr">Enghoff &amp; Golovatch, 1995</xref>, <italic>Siphonocryptus </italic><xref ref-type="bibr" rid="ref72">Pocock, 1894</xref>), which makes it the second most species-poor millipede order after the Siphoniulida (<xref rid="ref83" ref-type="bibr">Sierwald &amp; Bond, 2007</xref>; <xref ref-type="bibr" rid="ref55">Liu <italic>et al. </italic>2017</xref>). Despite their few species, Siphonocryptida show a very unusual distribution pattern. They occur in Sumatra (<italic>Siphonocryptus compactus </italic><xref ref-type="bibr" rid="ref72">Pocock, 1894</xref>), Malaysia (<italic>Siphonocryptus latior </italic><xref rid="ref28" ref-type="bibr">Enghoff &amp; Golovatch, 1995</xref>; <italic>Siphonocryptus zigzag </italic><xref ref-type="bibr" rid="ref25">Enghoff, 2010</xref>), Taiwan (<italic>Hirudicryptus taiwanensis </italic>Kors&#xf3;s<xref rid="ref50" ref-type="bibr">, Enghoff &amp; Chang, 2008</xref>), Nepal (<italic>Hirudicryptus quintelementum </italic><xref rid="ref51" ref-type="bibr">Kors&#xf3;s,
        Geoffroy &amp; Mauri&#xe8;s, 2009</xref>), Georgia and Russia (<italic>Hirudicryptus abchasicus </italic><xref rid="ref40" ref-type="bibr">Golovatch, Evsyukow &amp; Reip, 2015</xref>), and on the Macaronesian islands (<italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>)). Siphonocryptida probably had a wider distribution in the past and the today observed relict distribution might be due to extinction linked to changes in climate and vegetation (<xref ref-type="bibr" rid="ref51">Kors&#xf3;s <italic>et al., </italic>2009</xref>; <xref ref-type="bibr" rid="ref40">Golovatch <italic>et al., </italic>2015</xref>). The phylogenetic position of the Siphonocryptida within the Colobognatha remains unresolved (e.g. <xref rid="ref9" ref-type="bibr">Blanke &amp; Wesener, 2014</xref>), not the least because not a single genetic sequence is available, and their biology and internal anatomy remains largely <italic>terra incognita. </italic>The siphonocryptid species <italic>Hirudicryptus canariensis, </italic>which is endemic to Macaronesia, measures up to 10 mm in length and 1 mm in width and has a flattened body with lateral paraterga and a minute cone shaped head. The species was re-described in detail by Enghoff &amp; Golovatch (<xref rid="ref28" ref-type="bibr">1995</xref>) and the first data on its post-embryonic development was presented by Enghoff <italic>et al. </italic>(<xref ref-type="bibr" rid="ref27">1993</xref>) and Enghoff &amp; Golovatch (<xref rid="ref28" ref-type="bibr">1995</xref>).</p>
      <p><italic>Hirudicryptus canariensis </italic>is restricted to the volcanic islands Madeira, La Gomera and Tenerife (<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>; <xref rid="ref24" ref-type="bibr">Enghoff, 1992</xref>; <xref rid="ref28" ref-type="bibr">Enghoff &amp; Golovatch, 1995</xref>; <xref rid="ref93" ref-type="bibr">Vicente &amp; Enghoff, 1999</xref>), where it can only be found in the Laurisilva, evergreen laurel subtropical cloud-forests. Around 20 million years ago laurel forests could also be found in Southern Europe and Northern Africa. However, the laurel forest largely disappeared in the Mediterranean due to climatic changes in the Quaternary period, and it only persisted on the Macaronesian islands as a relic (<xref ref-type="bibr" rid="ref64">Morales <italic>et al., </italic>1996</xref>; <xref ref-type="bibr" rid="ref35">Fern&#xe1;ndez-Palacios <italic>et al., </italic>2011</xref>). On Tenerife, laurel forests occur in the Anaga Mountains in the east, the Monte del Agua in the west, and in small patches between those areas in the north of the island (<xref ref-type="bibr" rid="ref70">de Nascimento <italic>et al., </italic>2009</xref>; <xref rid="ref42" ref-type="bibr">Gonz&#xe1;lez-Montelongo &amp; P&#xe9;rez-Vargas, 2019</xref>). The evergreen Laurisilva on Tenerife is formed by ca. 20 tree species, of which many are Canarian endemics, and which vary in their composition according to the prevalent environmental conditions (<xref ref-type="bibr" rid="ref64">Morales <italic>et al., </italic>1996</xref>). For example, the heath <italic>Erica platycodon </italic>(<xref ref-type="bibr" rid="ref95">Webb &amp; Berthel.</xref>) Rivas-Mart. &amp; al. is part of the ridge-crest evergreen laurel forest ecosystem, which occurs at year-round cloudy and windy ridges with the highest precipitation (<xref ref-type="bibr" rid="ref3">del Arco Aguilar <italic>et al., </italic>2010</xref>). </p>
      <p>Here we present observations of the biology, habitat, and postembryonic development of <italic>Hirudicryptus canariensis </italic>in the Anaga-mountains of Tenerife (Canary Islands, Spain). Furthermore, we provide the first barcode data (CO1) for the order Siphonocryptida, which will aid in future identification.</p>
    </sec>
    <sec id="sec2">
      <title>Material and methods</title>
      <p content-type="bk"><sc>Collecting and observation</sc></p>
      <p><italic>Hirudicryptus canariensis </italic>was observed and collected on Tenerife (Canary Islands, Spain) in the laurel forest (Laurisilva) of the Anaga mountains in October 2019 at 9 localities ( <xref ref-type="table" rid="taw1">Table 1</xref>, <xref ref-type="fig" rid="fig1">Fig. 1a</xref>). The GPS-coordinates and elevation of each locality was recorded with the mobile-app <ext-link xlink:href="http://maps.me" ext-link-type="uri">maps.me</ext-link> (accessible via <ext-link xlink:href="https://maps.me/" ext-link-type="uri">https://maps.me/</ext-link>). For the publication localities were numbered from west to east, and locality numbers differ from those originally used when collecting. A distribution map (<xref ref-type="fig" rid="fig1">Fig. 1a</xref>) was generated in Q-GIS 3.8 Zanzibar (<xref rid="ref74" ref-type="bibr">QGIS Development Team 2019</xref>). Living specimens were observed and photographed in the field with an Olympus TG-5 digital camera equipped with an Olympus LG-1 light guide. Specimens from each locality were fixed in 95% ethanol and investigated with a Discovery.V12 stereomicroscope (Zeiss) to count the number of tergites and leg pairs, and to note the absence or presence of gonopods. This data has been combined with available data from the literature (<xref ref-type="bibr" rid="ref27">Enghoff <italic>et al., </italic>1993</xref>) to a total of 296 specimens (<xref ref-type="table" rid="taw2">Table 2</xref>). Specimens with less than 15 tergites were counted as juveniles of uncertain sex, specimens with 15 tergites or more were counted as females if gonopods were absent, or as males if gonopods werepresent (see below). Images of the different stadia were taken with a Keyence VHX2000. Furthermore, the tergite number and color pattern of 107 living specimens was recorded from photographs taken in the field. We did not combine the data from collected animals and animals photographed in the field to avoid artificial duplication of data, as some of the photographed animals might have been collected afterwards. As discussed by Enghoff <italic>et al. </italic>(<xref ref-type="bibr" rid="ref27">1993: 107</xref>) the Colobognatha do not have completely fused body-rings and the identification of segment or diplosegments can be problematic as the number of dorsal and ventral elements might not correspond to each other. Therefore, we rather refer to the number of tergites and leg-pairs added and to &#x2018;podous&#x2019; and &#x2018;apodous tergites&#x2019; respectively, assuming a legless collum followed by three haplosegments (tergites with a single leg-pair) and a variable number of diplosegments (tergites with two leg-pairs) as done by Enghoff <italic>et al. </italic>(<xref ref-type="bibr" rid="ref27">1993: 127-130</xref>) for Colobognatha. All data this study is based on, including additional photographs and tables, are deposited on Zenodo (<ext-link xlink:href="https://doi.org/10.5281/zenodo.6353889" ext-link-type="uri">https://doi.org/10.5281/zenodo.6353889</ext-link>).</p>
      <p content-type="bk"><sc>Scanning electron microscopy </sc>(<sc>SEM)</sc></p>
      <p>Scanning electron microscopy (SEM) was used to examine the number of ommatidia and antennomeres, as well as sexual characters (pseudopenes and gonopods). For SEM specimens were dehydrated in an ascending ethanol series and critical point dried with a Leica EM CPD 300. The specimens were mounted to SEM-stubs using conductive tape and sputtered with gold (ca 35 nm) using the Cressington Sputter Coater 108auto. SEM-images were obtained with a Zeiss Sigma 300 VP scanning electron microscope at the ZFMK. Here the number of antennomeres includes the apical disc (carrying the sensory cones) which is traditionally interpreted as 8<sup>th</sup> antennomere (e.g. <xref rid="ref90" ref-type="bibr">Verhoeff, 1928: 788</xref>; <xref rid="ref23" ref-type="bibr">Enghoff, 1990</xref>). For a discussion see Koch (<xref rid="ref49" ref-type="bibr">2015</xref>).</p>
      <p content-type="bk"><sc>Barcoding </sc>(<sc>CO</sc>1)</p>
      <p>DNA was extracted from two individual, one from locality 4 (ZFMK-MYR08837; ON007316) and one from locality 9 (ZFMK-MYR08838; ON007317). Following Spanish ABS bylaw 124/2017 of 24 February (Real Decreto 124/2017, de 24 de febrero, relativo al acceso a los recursos gen&#xe9;ticos procedentes de taxones silvestres y al control de la utilizaci&#xf3;n) access authorization for the utilization of genetic resources is not needed for exclusively taxonomic purposes (Capitoli I, Articolo 3.2) as defined in Capitoli I, Articolo 2.3 (<ext-link xlink:href="https://www.miteco.gob.es/en/biodiversidad/temas/recursos-geneticos/protocolo-de-nagoya/FAQ_Autorizaciones.aspx" ext-link-type="uri">https://www.miteco.gob.es/en/biodiversidad/temas/recursos-geneticos/protocolo-de-nagoya/FAQ_Autorizaciones.aspx</ext-link>). For DNA extraction, muscle tissue from legs and body segments was used. A fragment of the cytochrome&#xa0;c oxidase subunit I (CO1) mitochondrial gene was amplified with the primers HCO2198-JJ and LCO1490-JJ (<xref rid="ref6" ref-type="bibr">Astrin &amp; St&#xfc;ben, 2008</xref>) and sequenced as outlined in previous studies (e.g. <xref rid="ref97" ref-type="bibr">Wesener, 2015</xref>). BLAST searches (<xref ref-type="bibr" rid="ref2">Altschul <italic>et al., </italic>1990</xref>) were used to check the sequences for contaminations. Sequences were translated into amino acids to rule out the accidental amplification of pseudogenes. New sequences were uploaded to Genbank (see <xref ref-type="table" rid="taw4">Table 4</xref>).Sequences were aligned by hand in Bioedit (<xref rid="ref44" ref-type="bibr">Hall 1999</xref>). Distance analysis was performed in Mega 6 (<xref ref-type="bibr" rid="ref87">Tamura <italic>et al., </italic>2013</xref>) using the uncorrected p-distance model for a total of two sequences with 683 positions. Variation among sites was modeled with gamma distribution with shape parameter = 1. Included were the 1st+2nd+3rd codon positions.</p>
    </sec>
    <sec id="sec3">
      <title>Results</title>
      <p content-type="bk"><sc>Habitat and aggregations</sc></p>
      <p>We found <italic>Hirudicryptus canariensis </italic>exclusively on the heath <italic>Erica platycodon </italic>in the Anaga mountains at elevations between 630 and 870 m (<xref ref-type="table" rid="taw1">Table 1</xref>, <xref ref-type="fig" rid="fig1">Fig. 1a</xref>). The animals occurred only in humid places on the lower part of the trees, on or under its bark, or under moss growing on its trunk (<xref ref-type="fig" rid="fig1">Fig. 1b, c</xref>). Those habitats were also inhabited by julidan millipedes (Julidae and Blaniulidae), Collembola, and nymphs of <italic>Aneurus </italic>cf. <italic>tagasastei </italic><xref ref-type="bibr" rid="ref21">Enderlein, 1931</xref> (Heteroptera: Aradidae). Sifted soil samples taken adjacent to the trees and sampled with Winkler extraction did not include any specimens of <italic>H. canariensis.</italic></p>
      <p><italic>Hirudicryptus canariensis </italic>mostly occurred in accumulations of juveniles in different stadia and adults (<xref ref-type="fig" rid="fig2">Fig. 2a&#x2013;c</xref>), although at some localities only single (5) or few individuals (6, 7, 9), mainly adults, have been found. Larger individuals were often encountered coiled, with their head and collum stuck underneath the lateral paraterga of their mid-body (<xref ref-type="fig" rid="fig2">Fig. 2d, e</xref>). At several localities (1, 2, 3, 4 &amp; 8) <italic>H. canariensis </italic>was found in large numbers (<xref ref-type="fig" rid="fig2">Fig. 2a, b</xref>), in some spots counting several hundred individuals (e.g. 2 &amp; 4). Overall, most of the individuals found were juveniles of undetermined sex (63%), while males (19%) and females (18%) were nearly equally abundant. The highest proportion of juveniles of undetermined sex (90%) was found at locality 1 (<xref ref-type="fig" rid="fig1">Fig. 1a</xref>). </p>
      <p>Disturbance of aggregations led to a flight response by adults and juveniles, but no defense fluid was secreted. Removal of juveniles did not lead to any response by mature individuals in their surroundings. TW observed in March 2012 an adult individual of uncertain sex coiling around an egg clutch at locality 7.</p>
      <p>In one juvenile specimen with six tergites a fungus was observed growing on the basal article of one antenna (<xref ref-type="fig" rid="fig3">Fig. 3</xref>). </p>
      <fig position="anchor" id="fig1" orientation="portrait">
        <label>Fig. 1</label>
        <caption>
          <title>Distribution and habitat of <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>). <bold>a </bold>Distribution of <italic>H. canariensis </italic>in the Anaga mountains. Pie-charts indicate relative abundance of females (grey), males (black) and juveniles of undetermined sex with less than 15 tergites (white). Numbers refer to localities in <xref ref-type="table" rid="taw1">Table 1</xref>; L = Loksa (1967); E = Enghoff &amp; Golovatch (1995); V = Vicente&#xa0;&amp; Enghoff (1999); n = number of individuals examined. (Map modified from Corine Land Cover (CLC) 2006 (&#xa9; European Union, Copernicus Land Monitoring Service 2018, European Environment Agency (EEA)) <bold>b &amp; c </bold>The typical habitat of <italic>H. canariensis: </italic>Humid laurel forest on the slopes of the Anaga mountains (<bold>b</bold>), on and underneath the bark of the Macaronesian endemic <italic>Erica platycodon </italic>(<bold>c</bold>).</title>
          <p xml:lang="es">Fig. 1.&#x2014; Distribuci&#xf3;n y h&#xe1;bitat de <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>). <bold>a </bold>Distribuci&#xf3;n de <italic>H. canariensis </italic>en el macizo de Anaga. Los gr&#xe1;ficos circulares indican la abundancia relativa de hembras (gris), machos (negro) y juveniles de sexo indeterminado con menos de 15 terguitos (blanco). Los n&#xfa;meros se refieren a las localidades de la Tabla 1; L = Loksa (1967); E = Enghoff &amp; Golovatch (1995); V = Vicente &amp; Enghoff (1999); n = n&#xfa;mero de individuos examinados. (Mapa modificado a partir de Corine Land Cover (CLC) 2006 (&#xa9; Uni&#xf3;n Europea, Copernicus Land Monitoring Service 2018, Agencia Europea de Medio Ambiente (AEMA)) <bold>b &amp; c </bold>H&#xe1;bitat t&#xed;pico de <italic>H. canariensis: </italic>Bosque h&#xfa;medo de laurisilva en las laderas del macizo de Anaga (<bold>b), </bold>sobre y bajo la corteza del end&#xe9;mico <italic>Erica platycodon </italic>de Macaronesia (<bold>c)</bold>.</p>
        </caption>
        <graphic xlink:href="graellsia-79-1-e180-image1.png" position="float" orientation="portrait"/>
      </fig>
      <table-wrap position="float" id="taw1" orientation="portrait">
        <label>Table 1</label>
        <caption>
          <title>Localities of <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>) in the Anaga Mountains on Tenerife (Canary Islands, Spain). Abbreviations: Loc = locality number, Lat =latitude in decimal degree, Long = longitude in decimal degree, Elev = elevation in meter above sea level. </title>
          <p xml:lang="es">Tabla 1.&#x2014; Localidades de <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>) en el macizo de Anaga en Tenerife (Islas Canarias, Espa&#xf1;a). Abreviaturas: Loc = n&#xfa;mero de localidad, Lat = latitud en grado decimales, Long = longitud en grados decimales, Elev = elevaci&#xf3;n en metros sobre el nivel del mar.</p>
        </caption>
        <table id="tab1" content-type="middle center">
          <thead>
            <tr>
              <th colspan="1" rowspan="1">
                <bold>ZFMK-MYR</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>Loc</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>Locality</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>Lat (DG)</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>Long (DG)</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>Elev (m)</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>Date</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>Habitat</bold>
              </th>
            </tr>
          </thead>
          <tbody content-type="c3 left3 c8 left8">
            <tr>
              <td colspan="1" rowspan="1">08910</td>
              <td colspan="1" rowspan="1">
                <bold>1</bold>
              </td>
              <td colspan="1" rowspan="1">Cruz del Carmen, both sides of street</td>
              <td colspan="1" rowspan="1">28.530435</td>
              <td colspan="1" rowspan="1">-16.280268</td>
              <td colspan="1" rowspan="1">870</td>
              <td colspan="1" rowspan="1">07.x.2019</td>
              <td colspan="1" rowspan="1">Laurisilva, on and under bark of <italic>E. platycodon </italic>on slope. North slope</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">08911</td>
              <td colspan="1" rowspan="1">
                <bold>2</bold>
              </td>
              <td colspan="1" rowspan="1">Street between TF12 and Rio</td>
              <td colspan="1" rowspan="1">28.542069</td>
              <td colspan="1" rowspan="1">-16.274008</td>
              <td colspan="1" rowspan="1">806</td>
              <td colspan="1" rowspan="1">07.x.2019</td>
              <td colspan="1" rowspan="1">Laurisilva, on and under bark of <italic>E. platycodon </italic>on side and at slope under street. North slope</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">08914</td>
              <td colspan="1" rowspan="1">
                <bold>3</bold>
              </td>
              <td colspan="1" rowspan="1">TF12, between street to pico de ingles and street to Rio</td>
              <td colspan="1" rowspan="1">28.539815</td>
              <td colspan="1" rowspan="1">-16.271059</td>
              <td colspan="1" rowspan="1">890</td>
              <td colspan="1" rowspan="1">13.x.2019</td>
              <td colspan="1" rowspan="1">Laurisilva, on and under bark of <italic>E. platycodon, </italic>along slope under street. North slope</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">08906</td>
              <td colspan="1" rowspan="1">
                <bold>4</bold>
              </td>
              <td colspan="1" rowspan="1">TF12, close to bus stop Cruce de Las Carboneras, hiking path behind house</td>
              <td colspan="1" rowspan="1">28.53983</td>
              <td colspan="1" rowspan="1">-16.267142</td>
              <td colspan="1" rowspan="1">805</td>
              <td colspan="1" rowspan="1">6.x.2019</td>
              <td colspan="1" rowspan="1">Laurisilva, on and under bark of <italic>E. platycodon, </italic>next to path, ground covered by ferns. North slope</td>
            </tr>
            <tr>
              <td rowspan="1" colspan="1" content-type="nowrapt">08952&#x2013;08966</td>
              <td colspan="1" rowspan="1">
                <bold>4</bold>
              </td>
              <td colspan="1" rowspan="1">TF12, close to bus stop Cruce de Las Carboneras, hiking path behind house</td>
              <td colspan="1" rowspan="1">28.53983</td>
              <td colspan="1" rowspan="1">-16.267142</td>
              <td colspan="1" rowspan="1">805</td>
              <td colspan="1" rowspan="1">10.x.2019</td>
              <td colspan="1" rowspan="1">Laurisilva, on and under bark of <italic>E. platycodon, </italic>next to path, ground covered by ferns. North slope</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">08912</td>
              <td colspan="1" rowspan="1">
                <bold>5</bold>
              </td>
              <td colspan="1" rowspan="1">TF12, between Cruce de Afur and Cruce de Las Carboneras</td>
              <td colspan="1" rowspan="1">28.533626</td>
              <td colspan="1" rowspan="1">-16.247871</td>
              <td colspan="1" rowspan="1">733</td>
              <td colspan="1" rowspan="1">07.x.2019</td>
              <td colspan="1" rowspan="1">Laurisilva, on and under bark of <italic>E. platycodon </italic>at steep slope (trash and refrigerators). North slope</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">08913</td>
              <td colspan="1" rowspan="1">
                <bold>6</bold>
              </td>
              <td colspan="1" rowspan="1">Las Casas de la Cumbre</td>
              <td colspan="1" rowspan="1">28.53598</td>
              <td colspan="1" rowspan="1">-16.23949</td>
              <td colspan="1" rowspan="1">773</td>
              <td colspan="1" rowspan="1">07.x.2019</td>
              <td colspan="1" rowspan="1">Laurisilva, on and under bark of <italic>E. platycodon </italic>at steep slope. North slope</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">08907</td>
              <td colspan="1" rowspan="1">
                <bold>7</bold>
              </td>
              <td colspan="1" rowspan="1">Casas de la Cumbre, Casas Forestral</td>
              <td colspan="1" rowspan="1">28.542008</td>
              <td colspan="1" rowspan="1">-16.228718</td>
              <td colspan="1" rowspan="1">763</td>
              <td colspan="1" rowspan="1">06.x.2019</td>
              <td colspan="1" rowspan="1">Laurisilva, on and under bark of <italic>E. platycodon </italic>along hiking path behind Casa Forestral</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">08908</td>
              <td colspan="1" rowspan="1">
                <bold>8</bold>
              </td>
              <td colspan="1" rowspan="1">TF12, between Casas de la Cumbre and El Bailadero</td>
              <td colspan="1" rowspan="1">28.540909</td>
              <td colspan="1" rowspan="1">-16.193475</td>
              <td colspan="1" rowspan="1">709</td>
              <td colspan="1" rowspan="1">06.x.2019</td>
              <td colspan="1" rowspan="1">Laurisilva, on and under bark of <italic>E. platycodon. </italic>South slope</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">08909</td>
              <td colspan="1" rowspan="1">
                <bold>9</bold>
              </td>
              <td colspan="1" rowspan="1">El Bailadero, street to Las Bodegas and Lomo de las Casillas</td>
              <td colspan="1" rowspan="1">28.551742</td>
              <td colspan="1" rowspan="1">-16.193475</td>
              <td colspan="1" rowspan="1">637</td>
              <td colspan="1" rowspan="1">06.x.2019</td>
              <td colspan="1" rowspan="1">Laurisilva, on and under bark of <italic>E. platycodon </italic>along street.</td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <fig-group content-type="group" position="float" orientation="portrait" id="figg1">
        <fig position="anchor" id="fig2" orientation="portrait">
          <label>Fig. 2</label>
          <caption>
            <title><italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>), photographs of living specimens in the Anaga mountains (Spain, Tenerife). <bold>a&#xa0;&amp;&#xa0;b </bold>Aggregation with individuals of different stadia and sex with 6 to 36 tergites at locality 4. Aggregations can be relatively loose (<bold>a</bold>) or densely packed (<bold>b</bold>). <bold>c </bold>Group of individuals of different stadia. <bold>d </bold>Adult females with 30 and 39 tergites at locality 9, showing the typical coiled position, with the head underneath paraterga of the mid-body. <bold>e </bold>Single female individual with 47 tergites at locality 6. </title>
            <p xml:lang="es">Fig. 2.&#x2014; <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>), fotograf&#xed;as de ejemplares vivos en el macizo de Anaga (Espa&#xf1;a, Tenerife). <bold>a&#xa0;&amp;&#xa0;b&#xa0;</bold>Agregaci&#xf3;n con individuos de diferentes estadios y sexo con 6 a 36 terguitos en la localidad 4. Las agregaciones pueden ser relativamente sueltas (<bold>a) </bold>o densamente empaquetadas (<bold>b). c </bold>Grupo de individuos de diferentes estadios. <bold>d </bold>Hembras adultas con 30 y 39 terguitos en la localidad 9, mostrando la t&#xed;pica posici&#xf3;n enroscada, con la cabeza debajo de la paraterga de la parte media del cuerpo. <bold>e </bold>&#xda;nico individuo femenino con 47 terguitos en la localidad 6.</p>
          </caption>
          <graphic xlink:href="graellsia-79-1-e180-image2.png" position="float" orientation="portrait"/>
        </fig>
        <fig position="anchor" id="fig3" orientation="portrait">
          <label>Fig. 3</label>
          <caption>
            <title>Parasitic fungus on the antenna of a <italic>Hirudicryptus canariensis </italic>juvenile (stadium I). <bold>a </bold>Overview of antenna. <bold>b&#xa0;</bold>Detail of fungi. Scale: a = 100 &#xb5;m; b = 10 &#xb5;m.</title>
            <p xml:lang="es">Fig. 3.&#x2014; Hongo par&#xe1;sito en la antena de un juvenil de <italic>Hirudicryptus canariensis </italic>(estadio I). <bold>a </bold>Vista general de las antenas. <bold>b </bold>Detalle del hongo. Escala: a = 100 &#xb5;m; b = 10 &#xb5;m.</p>
          </caption>
          <graphic xlink:href="graellsia-79-1-e180-image3.png" position="float" orientation="portrait"/>
        </fig>
      </fig-group>
      <p><sc>Postembryonic development</sc></p>
      <p>The specimens with the lowest number of tergites had six tergites and seven leg pairs and lacked apodous tergites and coxal sacks (<xref ref-type="fig" rid="fig4">Fig. 4a</xref>); those were the most abundant individuals (<xref ref-type="table" rid="taw2">Table 2</xref>). Individuals with six tergites had a single pair of ommatidia, and five antennomeres (<xref ref-type="fig" rid="fig5">Fig. 5a</xref>) including the apical disc. Ozopores were present on tergites 5 and 6 (<xref ref-type="fig" rid="fig4">Fig. 4a</xref>). The next larger individuals counted ten tergites and 13 leg pairs (<xref ref-type="table" rid="taw2">Table 2</xref>).</p>
      <fig position="anchor" id="fig4" orientation="portrait">
        <label>Fig. 4</label>
        <caption>
          <title><italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>), scanning electron micrographs. <bold>a </bold>Juvenile, stadium I with 6 tergites and 7 leg pairs, habitus ventral view. <bold>b </bold>Juvenile, stadium II with 11 tergites and 15 leg pairs, habitus, ventral view. <bold>c </bold>Immature male, stadium III with 16 tergites and 25 leg pairs, habitus ventral view. <bold>d </bold>Mature male stadium IV, with 25 tergites and 43 leg pairs, habitus, ventral view. Scale: 100 &#xb5;m. Abbreviations: ag = anterior gonopod, co = collum, cs = coxal sacks, oz = ozopore, pg = posterior gonopod, pr = preanalring.</title>
          <p xml:lang="es">Fig. 4.&#x2014; <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>), micrograf&#xed;as electr&#xf3;nicas de barrido. <bold>a </bold>Juvenil, estadio I con 6 terguitos y 7 pares de patas, h&#xe1;bito vista ventral. <bold>b </bold>Juvenil, estadio II con 11 terguitos y 15 pares de patas, h&#xe1;bito vista ventral. <bold>c </bold>Macho inmaduro, estadio III con 16 terguitos y 25 pares de patas, h&#xe1;bito vista ventral. <bold>d </bold>Macho maduro, estadio IV, con 25 terguitos y 43 pares de patas, h&#xe1;bito vista ventral. Escala: 100 &#xb5;m. Abreviaturas: ag = gon&#xf3;podo anterior, co = collum, cs = sacos coxales, oz = ozoporo, pg = gon&#xf3;podo posterior, pr = anillo preanal.</p>
        </caption>
        <graphic xlink:href="graellsia-79-1-e180-image4.png" position="float" orientation="portrait"/>
      </fig>
      <table-wrap position="float" id="taw2" orientation="portrait" content-type="w68">
        <label>Table 2</label>
        <caption>
          <title>Postembryonic development of <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>). Locality numbers in parentheses corresponds to <xref ref-type="fig" rid="fig1">Fig. 1a</xref> and <xref ref-type="table" rid="taw1">Table 1</xref>. E = data from Enghoff <italic>et al. </italic>(<xref ref-type="bibr" rid="ref27">1993</xref>). </title>
          <p xml:lang="es">Tabla 2.&#x2014; Desarrollo postembrionario de <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>). Los n&#xfa;meros de localidad en par&#xe9;ntesis corresponden a la <xref ref-type="fig" rid="fig1">Fig. 1a</xref> y a la <xref ref-type="table" rid="taw1">Tabla 1</xref>. E = datos de Enghoff <italic>et al. </italic>(<xref ref-type="bibr" rid="ref27">1993</xref>).</p>
        </caption>
        <table id="tab2" content-type="center middle">
          <thead>
            <tr>
              <th colspan="1" rowspan="1">
                <bold>No. tergites</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>No. legpairs</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>No. of specimens (Locality)</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>Total no. of specimens</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>No. of specimens with gonopods (Locality)</bold>
              </th>
            </tr>
          </thead>
          <tbody>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>6</bold>
              </td>
              <td colspan="1" rowspan="1">7</td>
              <td colspan="1" rowspan="1">15(1), 10(2), 9(3), 39(4), 3(8), 7(E) </td>
              <td colspan="1" rowspan="1">83</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>10</bold>
              </td>
              <td colspan="1" rowspan="1">13</td>
              <td colspan="1" rowspan="1">1(1), 4(E) </td>
              <td colspan="1" rowspan="1">5</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>11</bold>
              </td>
              <td colspan="1" rowspan="1">15</td>
              <td colspan="1" rowspan="1">6(1), 2(2), 1(3), 5(4), 1(6), 3(8), 12(E) </td>
              <td colspan="1" rowspan="1">30</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>12</bold>
              </td>
              <td colspan="1" rowspan="1">17</td>
              <td colspan="1" rowspan="1">7(1), 1(2), 14(4), 6(8), 6(E)</td>
              <td colspan="1" rowspan="1">34</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>13</bold>
              </td>
              <td colspan="1" rowspan="1">19</td>
              <td colspan="1" rowspan="1">5(1), 1(2), 3(3), 11(4), 2(6), 1(7), 4(8)</td>
              <td colspan="1" rowspan="1">27</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>14</bold>
              </td>
              <td colspan="1" rowspan="1">21</td>
              <td colspan="1" rowspan="1">1(1), 2(2), 2(3), 8(4), 2(E)</td>
              <td colspan="1" rowspan="1">15</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>15</bold>
              </td>
              <td colspan="1" rowspan="1">23</td>
              <td colspan="1" rowspan="1">1(1), 1(4), 2(8), 1(E)</td>
              <td colspan="1" rowspan="1">5</td>
              <td colspan="1" rowspan="1">1(8)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>16</bold>
              </td>
              <td colspan="1" rowspan="1">25</td>
              <td colspan="1" rowspan="1">1(1), 3(2), 4(4), 1(E) </td>
              <td colspan="1" rowspan="1">9</td>
              <td colspan="1" rowspan="1">1(1),2(2),1(4),1(E) </td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>17</bold>
              </td>
              <td colspan="1" rowspan="1">27</td>
              <td colspan="1" rowspan="1">3(4), 3(8), 3(E) </td>
              <td colspan="1" rowspan="1">9</td>
              <td colspan="1" rowspan="1">2(4), 3(8), 1(E) </td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>18</bold>
              </td>
              <td colspan="1" rowspan="1">29</td>
              <td colspan="1" rowspan="1">5(4)</td>
              <td colspan="1" rowspan="1">5</td>
              <td colspan="1" rowspan="1">3(4)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>19</bold>
              </td>
              <td colspan="1" rowspan="1">31</td>
              <td colspan="1" rowspan="1">2(2), 4(4),1(8)</td>
              <td colspan="1" rowspan="1">7</td>
              <td colspan="1" rowspan="1">1(2), 3(4), 1(8),</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>20</bold>
              </td>
              <td colspan="1" rowspan="1">33</td>
              <td colspan="1" rowspan="1">3(2),1(4),1(8)</td>
              <td colspan="1" rowspan="1">5</td>
              <td colspan="1" rowspan="1">1(2), 1(4)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>21</bold>
              </td>
              <td colspan="1" rowspan="1">35</td>
              <td colspan="1" rowspan="1">2(2), 1(4)</td>
              <td colspan="1" rowspan="1">3</td>
              <td colspan="1" rowspan="1">1(4)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>22</bold>
              </td>
              <td colspan="1" rowspan="1">37</td>
              <td colspan="1" rowspan="1">1(2), 1(4)</td>
              <td colspan="1" rowspan="1">2</td>
              <td colspan="1" rowspan="1">1(4)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>23</bold>
              </td>
              <td colspan="1" rowspan="1">39</td>
              <td colspan="1" rowspan="1">1(1), 1(3), 3(4)</td>
              <td colspan="1" rowspan="1">5</td>
              <td colspan="1" rowspan="1">1(1), 1(3), 3(4)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>24</bold>
              </td>
              <td colspan="1" rowspan="1">41</td>
              <td colspan="1" rowspan="1">3(2), 1(4), 1(8)</td>
              <td colspan="1" rowspan="1">5</td>
              <td colspan="1" rowspan="1">3(2), 1(8)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>25</bold>
              </td>
              <td colspan="1" rowspan="1">43</td>
              <td colspan="1" rowspan="1">4(2), 1(7)</td>
              <td colspan="1" rowspan="1">5</td>
              <td colspan="1" rowspan="1">2(2)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>26</bold>
              </td>
              <td colspan="1" rowspan="1">45</td>
              <td colspan="1" rowspan="1">2(2), 1(3), 1(4), 3(7)</td>
              <td colspan="1" rowspan="1">7</td>
              <td colspan="1" rowspan="1">2(2), 1(4), 2(7)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>27</bold>
              </td>
              <td colspan="1" rowspan="1">47</td>
              <td colspan="1" rowspan="1">1(2), 1(3), 2(4)</td>
              <td colspan="1" rowspan="1">4</td>
              <td colspan="1" rowspan="1">1(4)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>28</bold>
              </td>
              <td colspan="1" rowspan="1">49</td>
              <td colspan="1" rowspan="1">1(1),1(2),1(3),1(4)</td>
              <td colspan="1" rowspan="1">4</td>
              <td colspan="1" rowspan="1">1(1),1(2)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>29</bold>
              </td>
              <td colspan="1" rowspan="1">51</td>
              <td colspan="1" rowspan="1">1(2), 1(4), 1(7)</td>
              <td colspan="1" rowspan="1">3</td>
              <td colspan="1" rowspan="1">1(7)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>30</bold>
              </td>
              <td colspan="1" rowspan="1">53</td>
              <td colspan="1" rowspan="1">1(2), 1(3), 1(9)</td>
              <td colspan="1" rowspan="1">3</td>
              <td colspan="1" rowspan="1">1(3)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>31</bold>
              </td>
              <td colspan="1" rowspan="1">55</td>
              <td colspan="1" rowspan="1">1(2), 2(3), 1(4)</td>
              <td colspan="1" rowspan="1">4</td>
              <td colspan="1" rowspan="1">1(2),1(3)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>32</bold>
              </td>
              <td colspan="1" rowspan="1">57</td>
              <td colspan="1" rowspan="1">1(2), 1(9)</td>
              <td colspan="1" rowspan="1">2</td>
              <td colspan="1" rowspan="1">1(2)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>33</bold>
              </td>
              <td colspan="1" rowspan="1">59</td>
              <td colspan="1" rowspan="1">2(2),1(3)</td>
              <td colspan="1" rowspan="1">3</td>
              <td colspan="1" rowspan="1">1(2),1(3)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>34</bold>
              </td>
              <td colspan="1" rowspan="1">61</td>
              <td colspan="1" rowspan="1">1(9)</td>
              <td colspan="1" rowspan="1">1</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>35</bold>
              </td>
              <td colspan="1" rowspan="1">63</td>
              <td colspan="1" rowspan="1">1(4)</td>
              <td colspan="1" rowspan="1">1</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>36</bold>
              </td>
              <td colspan="1" rowspan="1">65</td>
              <td colspan="1" rowspan="1">3(4),1(7)</td>
              <td colspan="1" rowspan="1">4</td>
              <td colspan="1" rowspan="1">2(4)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>38</bold>
              </td>
              <td colspan="1" rowspan="1">69</td>
              <td colspan="1" rowspan="1">1(4)</td>
              <td colspan="1" rowspan="1">1</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>39</bold>
              </td>
              <td colspan="1" rowspan="1">71</td>
              <td colspan="1" rowspan="1">1(9)</td>
              <td colspan="1" rowspan="1">1</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>41</bold>
              </td>
              <td colspan="1" rowspan="1">75</td>
              <td colspan="1" rowspan="1">1(6)</td>
              <td colspan="1" rowspan="1">1</td>
              <td colspan="1" rowspan="1">1(6)</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>47</bold>
              </td>
              <td colspan="1" rowspan="1">87</td>
              <td colspan="1" rowspan="1">1(6)</td>
              <td colspan="1" rowspan="1">1</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>49</bold>
              </td>
              <td colspan="1" rowspan="1">91</td>
              <td colspan="1" rowspan="1">1(7)</td>
              <td colspan="1" rowspan="1">1</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>54</bold>
              </td>
              <td colspan="1" rowspan="1">101</td>
              <td colspan="1" rowspan="1">1(5)</td>
              <td colspan="1" rowspan="1">1</td>
              <td colspan="1" rowspan="1">0</td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <fig position="anchor" id="fig5" orientation="portrait">
        <label>Fig. 5</label>
        <caption>
          <title>.&#x2014; <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>), somatic characters of the head, scanning electron micrographs. <bold>a </bold>Juvenile, stadium I with 6 tergites and 7 leg pairs, head. <bold>b </bold>Juvenile, stadium II with 11 tergites and 15 leg pairs, head. <bold>c </bold>Immature male, stadium III with 16 tergites and 25 leg pairs, head. <bold>d </bold>Mature male stadium IV, with 25 tergites and 43 leg pairs, head. Scale: 100&#xa0;&#xb5;m. Abbreviations: I-VII = antennomere, ad = apical disc/8<sup>th</sup> antennomere, co = collum, om = ommatidia.</title>
          <p xml:lang="es">Fig. 5.&#x2014; <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>), caracteres som&#xe1;ticos de la cabeza, micrograf&#xed;as electr&#xf3;nicas de barrido. <bold>a&#xa0;</bold>Juvenil, estadio I con 6 terguitos y 7 pares de patas, cabeza. <bold>b </bold>Juvenil, estadio II con 11 terguitos y 15 pares de patas, cabeza. <bold>c </bold>Macho inmaduro, estadio III con 16 terguitos y 25 pares de patas, cabeza. <bold>d </bold>Macho maduro, estadio IV, con 25 terguitos y 43 pares de patas, cabeza. Escala: 100 &#xb5;m. Abreviaturas: I-VII = anten&#xf3;mero, ad = disco apical/8&#xba; anten&#xf3;mero, co = collum, om = ommatidios.</p>
        </caption>
        <graphic xlink:href="graellsia-79-1-e180-image5.png" position="float" orientation="portrait"/>
      </fig>
      <p>Individuals with more than six tergites had a single apodous tergite, coxal sacks from leg-pair 3 onwards (<xref ref-type="fig" rid="fig4">Fig. 4b-d</xref>), and two pairs of ommatidia (<xref ref-type="fig" rid="fig5">Fig. 5b-d</xref>). The number of antennomeres (including apical disc) increased stepwise from five antennomeres in individuals with six tergites (<xref ref-type="fig" rid="fig5">Fig. 5a</xref>), via seven observed in individuals with eleven and 16 tergites (<xref ref-type="fig" rid="fig5">Fig. 5b, c</xref>), to a maximum of eight (<xref ref-type="fig" rid="fig5">Fig. 5d</xref>) observed in an individuals with 25 tergites (<xref ref-type="fig" rid="fig5">Fig. 5d</xref>).</p>
      <table-wrap position="float" id="taw3" orientation="portrait" content-type="w76">
        <label>Table 3</label>
        <caption>
          <title>Color pattern inferred from photographs of 107 living specimens of <italic>Hirudicryptus canariensis </italic>(<xref ref-type="bibr" rid="ref56">Loksa, 1967</xref>). Numbers indicate behind which tergite the following tergites became paler, number in parenthesis () indicates number of individuals in which this was observed, number in brackets [] indicates in how many individuals this was the maximum number of tergites.</title>
          <p xml:lang="es">Tabla 3.&#x2014; Patr&#xf3;n de color inferido a partir de fotograf&#xed;as de 107 ejemplares vivos de <italic>Hirudicryptus canariensis </italic>(<xref ref-type="bibr" rid="ref56">Loksa, 1967</xref>). Los n&#xfa;meros indican detr&#xe1;s de cu&#xe1;l terguito los terguitos subsucuentes se volvieron m&#xe1;s p&#xe1;lidos, el n&#xfa;mero entre par&#xe9;ntesis () indica el n&#xfa;mero de individuos en los que se observ&#xf3; esto, el n&#xfa;mero entre corchetes [] indica en cu&#xe1;ntos individuos &#xe9;ste fue el n&#xfa;mero m&#xe1;ximo de terguitos.</p>
        </caption>
        <table id="tab3">
          <thead>
            <tr>
              <th colspan="1" rowspan="1">
                <bold>Stadium (No. of color change)</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>1</bold>
                <bold>
                  <sup>st</sup>
                </bold>
                <bold>(0) </bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>2</bold>
                <bold>
                  <sup>nd</sup>
                </bold>
                <bold>(1)</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>3</bold>
                <bold>
                  <sup>rd</sup>
                </bold>
                <bold>(2)</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>4</bold>
                <bold>
                  <sup>th</sup>
                </bold>
                <bold>(3)</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>5</bold>
                <bold>
                  <sup>th</sup>
                </bold>
                <bold>(4)</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>6</bold>
                <bold>
                  <sup>th</sup>
                </bold>
                <bold>(5)</bold>
              </th>
            </tr>
          </thead>
          <tbody>
            <tr>
              <td colspan="1" rowspan="9">
                <bold>Tergite no. (no. of individuals with color change) [no of individuals with maximum tergite no.]</bold>
              </td>
              <td colspan="1" rowspan="1">6 (107)</td>
              <td colspan="1" rowspan="1">10 (8)[2]</td>
              <td colspan="1" rowspan="1">14 (2)[0]</td>
              <td colspan="1" rowspan="1">18 (0)[2]</td>
              <td colspan="1" rowspan="1">29 (0)[2]</td>
              <td colspan="1" rowspan="1">36 (0)[1]</td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1">11 (9)[6]</td>
              <td colspan="1" rowspan="1">15 (4)[1]</td>
              <td colspan="1" rowspan="1">21 (0)[3]</td>
              <td colspan="1" rowspan="1">31 (1)[0]</td>
              <td colspan="1" rowspan="1"/>
            </tr>
            <tr>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1">12 (12)[17]</td>
              <td colspan="1" rowspan="1">16 (1)[3]</td>
              <td colspan="1" rowspan="1">22 (0)[1]</td>
              <td colspan="1" rowspan="1">39 (0)[1]</td>
              <td colspan="1" rowspan="1"/>
            </tr>
            <tr>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1">13 (7)[30]</td>
              <td colspan="1" rowspan="1">17 (4)[7]</td>
              <td colspan="1" rowspan="1">23 (0)[2]</td>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1"/>
            </tr>
            <tr>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1">14 (7)[9]</td>
              <td colspan="1" rowspan="1">18 (4)[3]</td>
              <td colspan="1" rowspan="1">24 (1)[3]</td>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1"/>
            </tr>
            <tr>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1">19 (1)[5]</td>
              <td colspan="1" rowspan="1">25 (3)[1]</td>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1"/>
            </tr>
            <tr>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1">20 (1)[2]</td>
              <td colspan="1" rowspan="1">27 (0)[1]</td>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1"/>
            </tr>
            <tr>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1">21 (1)[2]</td>
              <td colspan="1" rowspan="1">28 (0)[1]</td>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1"/>
            </tr>
            <tr>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1">22 (0)[2]</td>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1"/>
              <td colspan="1" rowspan="1"/>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>Total</bold>
              </td>
              <td colspan="1" rowspan="1">(107)</td>
              <td colspan="1" rowspan="1">(43)[64]</td>
              <td colspan="1" rowspan="1">(18)[25]</td>
              <td colspan="1" rowspan="1">(4)[14]</td>
              <td colspan="1" rowspan="1">(1)[3]</td>
              <td colspan="1" rowspan="1">(0)[1]</td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <p>The specimens were white or pale brownish (Figs&#xa0;<xref ref-type="fig" rid="fig2">2c</xref>, <xref ref-type="fig" rid="fig6">6</xref>). In individuals with more than six tergites, a shift from darker to paler colored tergites could be observed. This color pattern was best visible in smaller living individuals (<xref ref-type="fig" rid="fig6">Fig. 6</xref>) and less distinct or absent in specimens stored in ethanol (<xref ref-type="fig" rid="fig7">Fig. 7</xref>) and in larger individuals. A shift from darker to paler coloration occurred behind tergite six (Figs <xref ref-type="fig" rid="fig6">6</xref>, <xref ref-type="fig" rid="fig7">7a-d</xref>) and behind tergite 10&#x2013;14 (Figs <xref ref-type="fig" rid="fig6">6</xref>, <xref ref-type="fig" rid="fig7">7e-h</xref>) as well as in some individuals behind tergite 14&#x2013;22 (<xref ref-type="fig" rid="fig6">Fig. 6</xref>). In few individuals such a pattern could also be observed on following tergites (<xref ref-type="table" rid="taw3">Table 3</xref>). Larger individuals of <italic>H.&#xa0;canariensis </italic>were generally darker and did not show such a clear pattern. The color pattern can be used to infer the stadia (see discussion).</p>
      <p>Modifications of the coxae of the second leg pair (which carry the gonopores) in both sexes, and of leg pair 9 and 10 (gonopods) in males, could be observed earliest in specimens with 15 tergites and 2 color shifts (stadium III). These structures were fully developed in specimens with 3 color shifts (stadium IV). No changes could be observed in larger individuals (<xref ref-type="fig" rid="fig8">Fig. 8</xref>). As the smallest individuals showing sexual modifications counted at least 15 tergites (<xref ref-type="table" rid="taw2">Table 2</xref>) and showed 2 color shifts, all individuals with less than 15 tergites and 2 color shifts were counted as juveniles of undetermined sex, while all individuals with at least 15 tergites and two color shift were counted as males if gonopods were present, or as females if gonopods were absent. In females with two color shifts (stadium III) the second coxae were enlarged and carried a mesal fold (<xref ref-type="fig" rid="fig8">Fig. 8a</xref>). In females with 3 (stadium IV) and more color shifts the operculum, and the inner and outer valves of the vulvae were fully developed, and the second sternite showed a median fold (<xref ref-type="fig" rid="fig8">Fig. 8b</xref>). In males with two color shifts (stadium III) the developing pseudopenes (gonoapophysis) on the coxae of leg pair 2 were cylindrical and blunt (<xref ref-type="fig" rid="fig8">Fig. 8c</xref>), while the fully developed pseudopenes of subsequent stadia were conical and carried an apical incision (<xref ref-type="fig" rid="fig8">Fig. 8d</xref>). The immature gonopods (<xref ref-type="fig" rid="fig8">Fig. 8e</xref>) mainly differed from the fully developed gonopods (<xref ref-type="fig" rid="fig8">Fig. 8f</xref>) by the shape and size of the flagellate extensions on the apicalpodomeres. The conspicuous lobe observed on fully developed anterior gonopods, extending beyond the surrounding setae (<xref ref-type="fig" rid="fig8">Fig. 8f</xref>), was in the immature gonopod represented by an inconspicuous extension, which was less than 1/3 of the length of the neighboring setae (<xref ref-type="fig" rid="fig8">Fig. 8e</xref>). The apical podomere of the posterior gonopod, which extended into a long flagellum and surpasses the anterior gonopod when fully developed (<xref ref-type="fig" rid="fig8">Fig. 8f</xref>), was in the immature gonopods a short and thin extension, which had ca. the length of podomere 5 (<xref ref-type="fig" rid="fig8">Fig. 8e</xref>). The largest male had 41 tergites and 75 leg pairs (<xref ref-type="fig" rid="fig7">Fig. 7i</xref>). The largest individual found was a female with 54 tergites and 101 leg pairs (Figs <xref ref-type="fig" rid="fig6">6</xref>, <xref ref-type="fig" rid="fig7">7j</xref>). The number of leg pairs was always uneven (<xref ref-type="table" rid="taw2">Table 2</xref>).</p>
      <fig-group content-type="group" position="float" orientation="portrait" id="figg2"><fig position="anchor" id="fig6" orientation="portrait">
        <label>Fig. 6</label>
        <caption>
          <title>Color pattern of <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>) during postembryonic development, photographs of living specimens. Yellow arrows and numbers indicate change from darker to paler tergites.</title>
          <p xml:lang="es">Fig. 6.&#x2014; Patr&#xf3;n de color de <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>) durante el desarrollo postembrionario, fotograf&#xed;as de ejemplares vivos. Las flechas amarillas y los n&#xfa;meros indican el cambio de los terguitos de m&#xe1;s oscuros a m&#xe1;s p&#xe1;lidos.</p>
        </caption>
        <graphic xlink:href="graellsia-79-1-e180-image6.png" position="float" orientation="portrait"/>
      </fig>
      <fig position="anchor" id="fig7" orientation="portrait">
        <label>Fig. 7</label>
        <caption>
          <title>Color pattern and tergite number of <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>) during postembryonic development, photographs of specimens in ethanol. <bold>a </bold>Juvenile with 10 tergites. <bold>b </bold>juvenile with 12 tergites. <bold>c </bold>Juvenile with 13 tergites. <bold>d </bold>Juvenile with 14 tergites. <bold>e </bold>Smallest male with 15 tergites. <bold>f </bold>Male with 16 tergites. <bold>g </bold>Male with17 tergites. <bold>h </bold>Male with 18 tergites. <bold>i&#xa0;</bold>Largest male with 41 tergites. <bold>j </bold>Largest female with 54 tergites. Scale: 500 &#xb5;m.</title>
          <p xml:lang="es">Fig. 7.&#x2014; Patr&#xf3;n de color y n&#xfa;mero de terguitos de <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>) durante el desarrollo postembrionario, fotograf&#xed;as de ejemplares en etanol. <bold>a </bold>Juvenil con 10 terguitos. <bold>b </bold>Juvenil con 12 terguitos. <bold>c </bold>Juvenil con 13 terguitos. <bold>d </bold>Juvenil con 14 terguitos. <bold>e </bold>Macho m&#xe1;s peque&#xf1;o con 15 terguitos. <bold>f </bold>Macho con 16 terguitos. <bold>g </bold>Macho con 17 terguitos. <bold>h </bold>Macho con 18 terguitos. <bold>i </bold>Macho m&#xe1;s grande con 41 terguitos. j Hembra m&#xe1;s grande con 54 terguitos. Escala: 500 &#xb5;m.</p>
        </caption>
        <graphic xlink:href="graellsia-79-1-e180-image7.png" position="float" orientation="portrait"/>
      </fig></fig-group>
      <p><sc>Barcodes and genetic analyses</sc></p>
      <p>The barcoded CO1 fragments (<xref ref-type="table" rid="taw4">Table 4</xref>) included 683 positions. The genetic pairwise distance between the two individuals from locality 4 and 9 was 0.5%</p>
      <table-wrap position="float" id="taw4" orientation="portrait">
        <label>Table 4</label>
        <caption>
          <title>Barcode sequence of the CO1-gene of <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>) with a total of 683 positions. For localities see <xref ref-type="table" rid="taw1">Table 1</xref> and <xref ref-type="fig" rid="fig1">Fig. 1a</xref>.</title>
          <p xml:lang="es">Tabla 4.&#x2014; Secuencia del gen CO1 de <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>) con un total de 683 posiciones. Para las localidades, v&#xe9;ase la <xref ref-type="table" rid="taw1">Tabla 1</xref> y la <xref ref-type="fig" rid="fig1">Fig. 1a</xref>.</p>
        </caption>
        <table id="tab4">
          <thead>
            <tr>
              <th colspan="1" rowspan="1">
                <bold>Specimen</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>Loc</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>Genbank</bold>
              </th>
              <th colspan="1" rowspan="1">
                <bold>Barcode (CO1) sequence</bold>
              </th>
            </tr>
          </thead>
          <tbody>
            <tr>
              <td colspan="1" rowspan="1" content-type="nowrapt">
                <bold>ZFMK-MYR08837</bold>
              </td>
              <td colspan="1" rowspan="1">4</td>
              <td colspan="1" rowspan="1">ON007316</td>
              <td colspan="1" rowspan="1"><preformat position="float" orientation="portrait" xml:space="preserve">CATAAAGATATCGGAACAATGTACTTTTTATTTGGTGTCCTAGCTGCCATATTAGGAACTGCATTAAGAATAATTATCCGATCAGAATTAGGTTTAATCGGTGGTCTCATTAACAATGATCAAACATATAACACAATTGTAACAGCCCACGCTTTCATCATAATTTTTTTTGTTGTTATACCAATCATAATAGGTGGTTTTGGAAATTGATTAACCCCTTTAATGATCGGAGCCCCTGATATAGCCTTCCCACGTTTAAATAATCTTAGTTTTTGATTACTACCTCCATCCCTAACACTTATAATTATATCTATATTTTTAGGGGGTGGTGCAGGAACAGGCTGAACAATCTACCCCCCACTATCTTCAGCACTAGGACACCCTAGAATCTCAGTAGATTTTGTAATCCTCTCTCTTCACCTAGCAGGAATCTCATCAATTCTAGGATCAATTAATTTCATTACAACAATCATAAATATACGTCCAAAAGAAATAACCATAGAACGAACCCCCTTATTTATTTGATCAGTATTATTAACAGCCCTTCTACTTCTATTGTCTCTACCCATCCTTGCTGGAGCAATCACAATACTCCTTACAGACCGAAATTTTAACACTTCATTTTTTGACCCTGTTGGGGGGGGAGACCCAATTTTATATCAACACCTATTTTGATTCTTTGG</preformat></td>
            </tr>
            <tr>
              <td colspan="1" rowspan="1">
                <bold>ZFMK-MYR08838 </bold>
              </td>
              <td colspan="1" rowspan="1">9</td>
              <td colspan="1" rowspan="1">ON007317</td>
              <td colspan="1" rowspan="1"><preformat position="float" orientation="portrait" xml:space="preserve">CATAAAGATATCGGAACAATGTACTTTTTATTTGGTGTCCTAGCTGCCATATTAGGAACTGCATTAAGAATAATTATCCGATCAGAATTAGGTTTAATCGGTGGTCTCATTAACAATGATCAAACATATAACACAATTGTAACAGCCCACGCTTTCATCATAATTTTTTTTGTTGTTATACCAATCATAATAGGTGGTTTTGGAAATTGATTAACCCCTTTAATGATCGGAGCCCCTGATATAGCCTTCCCACGTTTAAATAATCTTAGTTTTTGATTACTACCTCCATCCCTAACACTTATAATTATATCTATATTTTTAGGGGGTGGTGCAGGAACAGGCTGAACAATCTACCCCCCACTATCTTCAGCACTAGGACACCCTAGAATCTCAGTAGATTTTGTAATCCTCTCTCTTCACCTAGCAGGAATCTCATCAATTCTAGGATCAATTAATTTCATTACAACAATCATAAATATACGCCCAAAAGAAATAACCATAGAACGAACCCCCTTATTTATTTGATCAGTATTATTAACAGCCCTTCTACTTCTATTGTCTCTACCCATCCTTGCTGGAGCAATCACAATACTCCTTACAGACCGAAATTTTAACACTTCATTTTTTGACCCTGTCGGGGGAGGAGACCCAATTTTATATCAACACCTATTTTGATTCTTTGG</preformat></td>
            </tr>
          </tbody>
        </table>
      </table-wrap>
      <fig-group content-type="group" position="float" orientation="portrait" id="figg3"><fig position="anchor" id="fig8" orientation="portrait">
        <label>Fig. 8</label>
        <caption>
          <title><italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>), female and male sexual characters, scanning electron micrographs. <bold>a </bold>2<sup>nd</sup> coxae of immature female, stadium III with 20 tergites and 33 leg pairs. <bold>b </bold>2<sup>nd</sup> coxae of mature female, stadium IV with 25 tergites and 43 leg pairs. <bold>c </bold>2<sup>nd</sup> coxae of immature male, stadium III with 16 tergites and 25 leg pairs. <bold>d </bold>2<sup>nd</sup> coxae of mature male stadium IV, with 25 tergites and 43 leg pairs. <bold>e </bold>Gonopods of immature male, stadium III with 16 tergites and 25 leg pairs. <bold>f </bold>Gonopods of mature male stadium IV, with 25 tergites and 43 leg pairs. Scale: a&#x2013;d = 20 &#xb5;m, e, f = 100 &#xb5;m. Abbreviations: 1-6 = podomere, I-VII = antennomere, cx = coxa, ev = external valve, iv = internal valve, op = operculum, st = sternite.</title>
          <p xml:lang="es">Fig. 8.&#x2014; <italic>Hirudicryptus canariensis </italic>(<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>), caracteres sexuales femeninos y masculinos, micrograf&#xed;as electr&#xf3;nicas de barrido. <bold>a </bold>Coxas del 2&#xba; par de patas de una hembra inmadura, estadio III con 20 terguitos y 33 pares de patas. <bold>b </bold>Coxas del 2&#xba; par de patas de una hembra madura, estadio IV con 25 terguitos y 43 pares de patas. <bold>c </bold>Coxas del 2&#xba; par de patas de un macho inmaduro, estadio III con 16 terguitos y 25 pares de patas. <bold>d </bold>Coxas del 2&#xba; par de patas de un macho maduro, estadio IV, con 25 terguitos y 43 pares de patas. <bold>e </bold>Gon&#xf3;podos de un macho inmaduro, estadio III con 16 terguitos y 25 pares de patas. <bold>f </bold>Gon&#xf3;podos de un macho maduro, estadio IV, con 25 terguitos y 43 pares de patas. Escala: a&#x2013;d = 20 &#xb5;m, e, f = 100 &#xb5;m. Abreviaturas: 1-6 = pod&#xf3;mero, I-VII = anten&#xf3;mero, cx = coxa, ev = v&#xe1;lvula externa, iv = v&#xe1;lvula interna, op = op&#xe9;rculo, st = esternito.</p>
        </caption>
        <graphic xlink:href="graellsia-79-1-e180-image8.png" position="float" orientation="portrait"/>
      </fig>
      <fig position="anchor" id="fig9" orientation="portrait">
        <label>Fig. 9</label>
        <caption>
          <title>Body plan of stadium I juveniles of different Colobognatha. <italic>Polyzonium germanicum </italic>after Rimsky-Korsakow (<xref ref-type="bibr" rid="ref79">1895</xref>) and David &amp; Couret (<xref rid="ref17" ref-type="bibr">1983</xref>, <xref ref-type="bibr" rid="ref19">1985</xref>), <italic>Brachycybe nodulosa </italic>after Murakami (1962b), <italic>Brachycybe lecontii </italic>after Wong <italic>et al. </italic>(2020).</title>
          <p xml:lang="es">Fig. 9.&#x2014; Plan corporal de los juveniles del estadio I de diferentes Colobognatha. <italic>Polyzonium germanicum </italic>seg&#xfa;n Rimsky-Korsakow (<xref ref-type="bibr" rid="ref79">1895</xref>) y David &amp; Couret (<xref rid="ref17" ref-type="bibr">1983</xref>, <xref ref-type="bibr" rid="ref19">1985</xref>), <italic>Brachycybe nodulosa </italic>seg&#xfa;n Murakami (1962b), <italic>Brachycybe lecontii </italic>seg&#xfa;n Wong <italic>et al. </italic>(2020).</p>
        </caption>
        <graphic xlink:href="graellsia-79-1-e180-image9.png" position="float" orientation="portrait"/>
      </fig>
 </fig-group>   </sec>
    <sec id="sec4">
      <title>Discussion</title>
      <p content-type="bk"><sc>Habitat and distribution</sc></p>
      <p><italic>Hirudicryptus canariensis </italic>seems to be associated to the plant <italic>Erica platycodon </italic>[<italic>Erica scoparia </italic>subsp. <italic>platycodon </italic>(<xref ref-type="bibr" rid="ref95">Webb &amp; Berthel.</xref>) <xref ref-type="bibr" rid="ref45">A.Hansen &amp; G.Kunkel</xref>] and humid conditions, as it has only been found on those trees and not in its surrounding in this study. For <italic>H. canariensis </italic>from La Gomera and Madeira we lack information on which plant they occurred (<xref rid="ref28" ref-type="bibr">Enghoff &amp; Golovatch, 1995</xref>). <italic>Erica platycodon </italic>has the two subspecies <italic>Erica platycodon </italic>subsp. <italic>platycodon, </italic>endemic to the Canary Islands, and <italic>Erica platycodon </italic>subsp. <italic>maderincola </italic>(D.C.McClint.) Rivas Mart. &amp; al., endemic to Madeira (e.g. <xref ref-type="bibr" rid="ref80">Rivas-Martinez <italic>et al., </italic>1993</xref>; <xref ref-type="bibr" rid="ref5">Arozena <italic>et al., </italic>2008</xref>; <xref ref-type="bibr" rid="ref33">Fag&#xfa;ndez <italic>et al., </italic>2009</xref>; <xref rid="ref73" ref-type="bibr">POWO, 2022</xref>). The close affinity of <italic>H. canariensis </italic>to <italic>Erica platycodon </italic>might be related to the structure of the bark of <italic>Erica platycodon, </italic>which easily peels off and creates abundant crevices. With its small (up to 10 mm in length, ca 1 mm in width) and dorso-ventrally flattened body, <italic>H. canariensis </italic>might be adapted toa subcortical life, as small and flattened bodies are typical for subcortical millipedes (<xref rid="ref41" ref-type="bibr">Golovatch &amp; Kime. 2009</xref>). However, other siphonocryptids (<italic>Hirudicryptus abchasicus, H. taiwanensis, H. quintumelementum, Siphonocryptus zigzag </italic>and <italic>S. latior</italic>) with a similar habitus are known to inhabit soil and leaf litter (<xref rid="ref28" ref-type="bibr">Enghoff &amp; Golovatch, 1995</xref>; <xref ref-type="bibr" rid="ref50">Kors&#xf3;s <italic>et al., </italic>2008</xref>, <xref ref-type="bibr" rid="ref51">2009</xref>; <xref rid="ref25" ref-type="bibr">Enghoff, 2010</xref>; <xref ref-type="bibr" rid="ref40">Golovatch <italic>et al., </italic>2015</xref>; <xref rid="ref101" ref-type="bibr">Zuev, 2017</xref>). On the Canary Islands, <italic>Erica platycodon </italic>is mainly found in the ridge-crest evergreen laurel forests, which occurs at year-round cloudy and windy ridges, where the highest precipitation occurs (<xref ref-type="bibr" rid="ref3">del Arco Aguilar <italic>et al., </italic>2010</xref>). Therefore, the presence of <italic>H. canariensis </italic>on <italic>Erica platycodon </italic>might be related to favorable conditions, with high humidity due to precipitation of mist, where <italic>E. platycodon </italic>growth. The distribution of <italic>E. platycodon </italic>(<xref ref-type="bibr" rid="ref43">Government of the Canary Islands</xref>) matches (with the exception of its presence on El Hierro, where <italic>H. canariensis </italic>is currently unknown) the knowndistribution of <italic>H.&#xa0;canariensis </italic>on Tenerife, La Gomera and Madeira (<xref rid="ref56" ref-type="bibr">Loksa, 1967</xref>; <xref rid="ref24" ref-type="bibr">Enghoff, 1992</xref>; <xref rid="ref28" ref-type="bibr">Enghoff &amp; Golovatch, 1995</xref>; <xref rid="ref93" ref-type="bibr">Vicente &amp; Enghoff, 1999</xref>). These laurel forests are a tertiary relict of the subtropical North Thetian forest (<xref ref-type="bibr" rid="ref3">del Arco Aguilar <italic>et al., </italic>2010</xref>) and harbor a great biodiversity with high levels of endemism (e.g. <xref rid="ref57" ref-type="bibr">Machado, 1976</xref>; <xref ref-type="bibr" rid="ref8">Betzin <italic>et al., </italic>2016</xref>). The absence of <italic>H. canariensis </italic>on El Hierro is either due to a lack of collecting efforts, or more likely the relatively young age of El Hierro (1.1 Ma) compared to Tenerife (11.5 Ma), La Gomera (12 Ma) (<xref rid="ref36" ref-type="bibr">Fern&#xe1;ndez-Palacios &amp; Whittaker, 2008</xref>) and Madeira (5 Ma) (<xref ref-type="bibr" rid="ref38">Geldmacher <italic>et&#xa0;al., </italic>2000</xref>, <xref ref-type="bibr" rid="ref39">2005</xref>), and the low dispersal ability of <italic>H. canariensis </italic>compared to the wind-dispersed heathers.</p>
      <p>The patchy distribution of the Siphonocryptida is probably the result of extinction events of a once wider Palearctic distribution related to changes in climate and vegetation, as already pointed out by Kors&#xf3;s <italic>et al. </italic>(<xref ref-type="bibr" rid="ref50">2008</xref>, <xref ref-type="bibr" rid="ref51">2009</xref>) and Golovatch <italic>et al. </italic>(<xref ref-type="bibr" rid="ref40">2015</xref>). Thus, the laurel forests largely disappeared in Europe and only persist in relic habitats on Madeira and the Canary Islands (<xref ref-type="bibr" rid="ref35">Fern&#xe1;ndez-Palacios <italic>et al., </italic>2011</xref>) alongside <italic>H.&#xa0;canariensis.</italic></p>
      <p content-type="bk"><sc>Sociality and aggregations</sc></p>
      <p>We suggest that <italic>Hirudicryptus canariensis </italic>is social (<xref rid="ref15" ref-type="bibr">Costa, 2018</xref>) or subsocial (<xref rid="ref13" ref-type="bibr">Choe &amp; Crespi, 1997</xref>) with parental brood care (see also <xref rid="ref9" ref-type="bibr">Blanke &amp; Wesener, 2014</xref>; their character 52) and forms aggregations. Yip&#xa0;&amp; Rayor (<xref rid="ref100" ref-type="bibr">2014</xref>) subdivide subsociality, defining egg-guarding alone as &#x2018;transient subsociality&#x2019; in contrast to &#x2018;prolonged subsociality&#x2019;, which is defined as the guarding of juveniles or larvae over some period of time. As only eggs are guarded and disturbance of aggregations of juvenile and mature individuals did not lead to any protective response by the latter, we consider <italic>H. canariensis </italic>as &#x2018;transient subsocial&#x2019;. <italic>Hirudicryptus canariensis </italic>forms aggregations with large numbers of individuals of different stadia, where it is not clear whether this is the result of preferable conditions and availability of food or indicates sociality (i.e. attraction and interaction to each other). Such aggregations of <italic>H. canariensis </italic>have not been reported before and juveniles have been collected singly (<xref rid="ref28" ref-type="bibr">Enghoff &amp; Golovatch, 1995</xref>). There are reports on social and colonial behavior in other Colobognatha (e.g. <xref ref-type="bibr" rid="ref29">Enghoff <italic>et al., </italic>2015</xref>):Aggregation behavior of individuals of overlapping generations, as well as paternal brood care has been reported for the platydesmids <italic>Brachycybe lecontii </italic><xref ref-type="bibr" rid="ref99">Wood, 1864</xref> (<xref ref-type="bibr" rid="ref37">Gardner, 1974</xref>; <xref ref-type="bibr" rid="ref98">Wong <italic>et al., </italic>2020</xref>), <italic>Brachycybe nodulosa </italic>(<xref rid="ref91" ref-type="bibr">Verhoeff, 1935</xref>) (<xref rid="ref67" ref-type="bibr">Murakami, 1962a</xref>; <xref ref-type="bibr" rid="ref52">Kudo <italic>et al., </italic>2011</xref>) and <italic>Yamasinaium noduligerum </italic><xref ref-type="bibr" rid="ref92">Verhoeff, 1939</xref> (<xref ref-type="bibr" rid="ref53">Kudo <italic>et al., </italic>2009</xref>), while maternal brood care has been reported for the platydesmids <italic>Dolistenus savii </italic><xref ref-type="bibr" rid="ref34">Fanzago, 1874</xref> (<xref ref-type="bibr" rid="ref84">Silvestri, 1950</xref>) and <italic>Dolistenus humicolus </italic><xref ref-type="bibr" rid="ref89">Verhoeff 1926</xref> (<xref ref-type="bibr" rid="ref62">Minelli, 1981</xref>), as well as for the polyzoniids <italic>Orsiboe ichigomensis </italic><xref ref-type="bibr" rid="ref7">Attems, 1909</xref> (<xref rid="ref67" ref-type="bibr">Murakami, 1962a</xref>) and <italic>Polyzonium germanicum </italic><xref ref-type="bibr" rid="ref10">Brandt, 1837</xref> (<xref ref-type="bibr" rid="ref79">Rimsky-Korsakow, 1895</xref>; <xref rid="ref90" ref-type="bibr">Verhoeff, 1928</xref>). Therefore, parental care could be a common feature of the Colobognatha but needs further investigations of more taxa. So far brood care has not been reported for Siphonophorida. As in the platydesmidan <italic>Brachycybe nodulosa </italic>(<xref rid="ref67" ref-type="bibr">Murakami, 1962a</xref>), the ratio of females to males in aggregations of <italic>Hirudicryptus canariensis </italic>is almost 1:1 (<xref ref-type="fig" rid="fig1">Fig. 1a</xref>), while a female biased sex ratio has been reported for <italic>Brachycybe lecontii </italic>(<xref ref-type="bibr" rid="ref98">Wong <italic>et al. </italic>2020</xref>) and <italic>Pseudodesmus </italic>sp. (<xref rid="ref54" ref-type="bibr">Lewis 1984</xref>).</p>
      <p content-type="bk"><sc>Post embryonic development &#x2013; stadium I</sc></p>
      <p>Based on the available material we suggest that <italic>Hirudicryptus canariensis </italic>hatches with six tergites and seven leg pairs (= stadium I). Enghoff <italic>et al. </italic>(<xref ref-type="bibr" rid="ref27">1993</xref>) and Enghoff &amp; Golovatch (<xref rid="ref28" ref-type="bibr">1995</xref>) also report the smallest individuals to have six tergites and seven leg pairs but suspect that these might represent stadium II. We argue that these individuals represent stadium I, because no smaller individuals could be found despite extensive sampling, and more importantly, stadium I individuals of other colobognathan taxa (Polyzoniida and Platydesmida) also have six tergites. However, the number of legs (<xref ref-type="fig" rid="fig8">Fig. 8</xref>) varies, with six tergites and four leg pairs in <italic>Polyzonium germanicum </italic>and <italic>Brachycybe nodulosa </italic>(<xref rid="ref79" ref-type="bibr">Rimsky-Korsakow, 1895</xref>; <xref rid="ref68" ref-type="bibr">Murakami, 1962b</xref>; <xref rid="ref17" ref-type="bibr">David &amp; Couret, 1983</xref>, <xref ref-type="bibr" rid="ref19">1985</xref>; <xref ref-type="bibr" rid="ref27">Enghoff <italic>et al., </italic>1993</xref>), and six tergites and five leg pairs in <italic>Brachycybe lecontii </italic>(<xref ref-type="bibr" rid="ref98">Wong <italic>et al., </italic>2020</xref>) (<xref ref-type="fig" rid="fig8">Fig. 8</xref>). Stadium II already has eight or more tergites in Polyzoniida (<xref rid="ref17" ref-type="bibr">David &amp; Couret, 1983</xref>; <xref ref-type="bibr" rid="ref27">Enghoff <italic>et al.,</italic>1993</xref>) and Platydesmida (<xref rid="ref69" ref-type="bibr">Murakami, 1963</xref>; <xref ref-type="bibr" rid="ref98">Wong <italic>et al., </italic>2020</xref>). We suggest that in stadium I the ultimate tergite, which is apodous in Polyzoniida and Platydesmida (<xref rid="ref68" ref-type="bibr">Murakami, 1962b</xref>; <xref rid="ref17" ref-type="bibr">David &amp; Couret, 1983</xref>; <xref ref-type="bibr" rid="ref98">Wong <italic>et al., </italic>2020</xref>), carries two leg pairs in <italic>H.&#xa0;canariensis, </italic>while only in the following stadia the ultimate tergite is apodous, as is the case in the remaining Colobognatha. Thus, podous tergites develop without an apodous precursor between stadium I and stadium II. Other characters supporting that <italic>H.&#xa0;canariensis </italic>with six tergites represent stadium I are (1) the presence of a single pair of ommatidia, (2) antennae consisting of only five antennomeres (including the apical disc), and (3) the absence of coxal sacks. (1) A single pair of ommatidia is also present in stadium I of <italic>Polyzonium germancium. </italic>(2)&#xa0;Only five antennomeres are present in stadium I of <italic>P.&#xa0;germanicum </italic>(<xref rid="ref79" ref-type="bibr">Rimsky-Korsakow, 1895</xref>), <italic>Brachycybe nodulosa </italic>(<xref rid="ref68" ref-type="bibr">Murakami, 1962b</xref>) and <italic>Brachycybe lecontii </italic>(<xref ref-type="bibr" rid="ref98">Wong <italic>et al., </italic>2020: fig. 5</xref>),while the following stadia carry more ommatidia (if present) and antennomeres (seven antennomeres in stadium II, eight antennomeres in following stadia (<xref ref-type="bibr" rid="ref98">Wong <italic>et al., </italic>2020: fig. 5</xref>; including apical disc), as is also the case in <italic>H. canariensis. </italic>(3) Coxal sacks, only present in <italic>H.&#xa0;canariensis </italic>with more than six tergites, first appear in <italic>Brachycybe lecontii </italic>in individuals of stadium II (<xref ref-type="bibr" rid="ref98">Wong <italic>et al., </italic>2020</xref>), while for other Colobognatha this state has not been documented.</p>
      <p content-type="bk"><sc>Post embryonic development &#x2013; subsequent stadia</sc></p>
      <p>In juveniles and younger mature individuals of <italic>Hirudicryptus canariensis, </italic>the more or less regular color pattern corresponds to the total tergite numbers commonly observed in smaller individuals. We suggest that the color pattern can be used to trace the postembryonic development of the earliest stadia, as might be the case in several millipedes like some Platydesmida and the syphonocryptid <italic>Siphonocryptus zigzag </italic><xref ref-type="bibr" rid="ref25">Enghoff, 2010</xref>, which show a trans-segmental color pattern (<xref ref-type="bibr" rid="ref26">Enghoff, 2011</xref>). In <italic>H. canariensis </italic>we observed rather a change in intensity than a well-developed trans-segmental pattern. The anterior six tergites (corresponding to stadium I) are often darker than the following tergites, and juveniles with 6 tergites were common. Subsequent shifts from darker to paler tergites could be observed in several individuals behind tergite 10&#x2013;14, 14&#x2013;22 and 18&#x2013;28, which corresponds to the total numbers of tergites observed in some individuals. Based on the color pattern and the tergite numbers observed, we conclude that the number of color shifts +1 gives the number of the stadium, and that stadium I has 6 tergites and 7 leg pairs, stadium II has 10&#x2013;14 tergites and 13&#x2013;21 leg pairs, stadium III has 14&#x2013;22 tergites and 21&#x2013;37 leg pairs, and stadium IV has 18&#x2013;28 tergites and 29&#x2013;49 leg pairs. This is largely in congruence with the postembryonic development known from the platydesmid<italic>Brachycybe nodulosa, </italic>in which stadium I has 6 tergites, stadium II has 10&#x2013;14 tergites, stadium 3 has 15&#x2013;21 tergites and stadium IV has 21&#x2013;29 tergites (<xref rid="ref69" ref-type="bibr">Murakami, 1963: fig. 1</xref>). In <italic>H. canariensis </italic>the number of tergites and legs added during molting is irregular and can overlap between individuals of different stadia as is the case in <italic>Polyzonium germanicum </italic>(<xref rid="ref17" ref-type="bibr">David &amp; Couret, 1983</xref>, <xref ref-type="bibr" rid="ref18">1984</xref>) and <italic>Brachycybe </italic>(<xref rid="ref69" ref-type="bibr">Murakami, 1963</xref>; <xref ref-type="bibr" rid="ref98">Wong <italic>et al., </italic>2020</xref>), and therefore is not reliable for the determination of stadia. In contrast to that, <italic>Hirudisoma latum </italic>(<xref rid="ref78" ref-type="bibr">Ribaut, 1908</xref>) has a fixed number of tergites and leg pairs per stadium (<xref rid="ref12" ref-type="bibr">Brolemann, 1935</xref>; <xref ref-type="bibr" rid="ref27">Enghoff <italic>et al., </italic>1993</xref>). In <italic>H. canariensis </italic>there is a strict correspondence between the always odd number of leg pairs (l) and the number of tergites (t), and it can be calculated with the formula l = 3 + 2(t &#x2013; 5) (the number of haplosegments with a single leg pair is 3, the number of diplosegments with two leg-pairs is t &#x2013; 5, as the collum and the ultimate diplosegment do not carry legs, and the 3 haplosegments have to be excluded).This formula applies for all stadia except for stadium I, which lacks an apodous tergite. In <italic>Polyzonium germanicum </italic>(<xref rid="ref17" ref-type="bibr">David &amp; Couret, 1983</xref>; <xref ref-type="bibr" rid="ref27">Enghoff <italic>et al., </italic>1993</xref>) and <italic>Brachycybe </italic>(<xref rid="ref69" ref-type="bibr">Murakami, 1963</xref>; <xref ref-type="bibr" rid="ref98">Wong <italic>et al., </italic>2020</xref>), individuals with the same number of tergites can have a variable numbers of leg pairs, which is always even in <italic>P. germanicum </italic>(<xref rid="ref17" ref-type="bibr">David &amp; Couret, 1983</xref>). In other Colobognatha there can be several apodous ultimate tergites (e.g. Murakami (<xref rid="ref69" ref-type="bibr">1963</xref>) and Wong <italic>et al. </italic>(<xref ref-type="bibr" rid="ref98">2020</xref>) for Platydesmida, David &amp; Couret (<xref rid="ref18" ref-type="bibr">1984</xref>) for Polyzoniida). In contrast there is always only a single apodous ultimate tergite in <italic>H. canariensis. </italic>This means that in <italic>H. canariensis </italic>several podous tergites can develop de novo without an apodous precursor (or from a single apodous tergite), while in <italic>Polyzonium germanicum </italic>the number of new podous tergites always corresponds to the number of apodous tergites in the previous stadium (<xref rid="ref17" ref-type="bibr">David &amp; Couret 1983: table 5</xref>). Like the remaining Colobognatha <italic>H. canariensis
        </italic>develops by euanamorphosis; i.e. segments are added during each molt throughout life (<xref ref-type="bibr" rid="ref27">Enghoff <italic>et al., </italic>1993</xref>; <xref rid="ref63" ref-type="bibr">Minelli, 2015</xref>).</p>
      <p>We suggest that in <italic>H. canariensis </italic>the sexual characters of both sexes (vulvae, penes, gonopods) develop gradually via two molts, with not fully developed structures in stadium III (with 2 color shifts), and fully developed structures in stadium IV (with 3 color shifts). In subsequent stadia the external structure of the sexual organs does not change, which is of importance for taxonomic studies, which largely rely on gonopods for species identification. The smallest individuals of <italic>H. canariensis </italic>showing sexual modifications (including immature gonopods) observed in this study had 15 tergites, while the smallest individual reported by Enghoff <italic>et al. </italic>(<xref ref-type="bibr" rid="ref27">1993</xref>) and Enghoff &amp; Golovatch (<xref rid="ref28" ref-type="bibr">1995</xref>) had 16 tergites. Our observations correspond to the first appearance of immature gonopods in <italic>Polyzonium germanicum </italic>with 15&#x2013;21 tergites (<xref rid="ref17" ref-type="bibr">David &amp; Couret, 1983</xref>), and in <italic>Hirudisoma latum </italic>with 15 tergites (<xref rid="ref12" ref-type="bibr">Brolemann, 1935</xref>; therein 16 including preanal ring), although these are considered as stadium IV. In <italic>H. canariensis, </italic>fully developed gonopods could be observed in stadium IV, while these appear in stadium V in <italic>P. germanicum </italic>(<xref rid="ref17" ref-type="bibr">David &amp; Couret, 1983</xref>) and <italic>H.
        latum </italic>(<xref rid="ref12" ref-type="bibr">Brolemann, 1935</xref>). In the platydesmidan <italic>Brachycybe nodulosa </italic>males and females can be distinguished from stadia III onwards, suggesting the presence of leg-modifications in this stadium (<xref rid="ref69" ref-type="bibr">Murakami, 1963: table 3</xref>). In <italic>B. lecontii </italic>immature gonopods first appear in individuals with 24 tergites, corresponding to stadium IV, and are fully developed in individuals with at least 35 tergites, corresponding to stadia V&#x2013;VII (<xref ref-type="bibr" rid="ref98">Wong <italic>et al. </italic>2020</xref>). As the phylogeny of the Colobognatha remains unresolved (e.g. <xref rid="ref9" ref-type="bibr">Blanke &amp; Wesener 2014</xref>) and the development is only known for very few colobognathan species it remains unknown how these different developmental patterns evolved. </p>
      <p content-type="bk"><sc>Fungi </sc></p>
      <p>The fungus growing on the antennae of a juvenile (stadia I) of <italic>H. canariensis </italic>does not belong to the Laboulbeniales, which are commonly reported from millipedes (e.g. <xref ref-type="bibr" rid="ref81">Santamaria <italic>et al. </italic>2014</xref>, <xref ref-type="bibr" rid="ref82">2016</xref>; <xref rid="ref31" ref-type="bibr">Enghoff &amp; Santamaria 2015</xref>), but is one of the less known non-Laboulbenialean fungi associated to millipedes as reported by Enghoff &amp; Reboleira (<xref rid="ref30" ref-type="bibr">2017</xref>). To our knowledge, this is the first parasitic fungus reported from a colobognathan millipede.</p>
      <p content-type="bk"><sc>Barcodes and genetic analyses</sc></p>
      <p>The genetic distance of 0.5% between the two analyzed specimens of <italic>Hirudicryptus canariensis </italic>is relatively low, as for <italic>Glomeris marginata </italic>(<xref rid="ref94" ref-type="bibr">Villers, 1789</xref>) intraspecific genetic distances of up to 4.7% are reported (<xref rid="ref77" ref-type="bibr">Reip &amp; Wesener, 2018</xref>). This high similarity in <italic>H. canariensis </italic>is most likely due to the geographical proximity of the populations with a distance of 7.3 km. Generally, the genetic distance increases with geographical distance, although in some cases <italic>Glomeris marginata </italic>showed 0.0% genetic p-distance between individuals sampled more than 1000 km apart, while larger genetic p-distances of 3% occurred in closer proximity of 9 km (<xref rid="ref77" ref-type="bibr">Reip &amp; Wesener, 2018</xref>). The moderate genetic distance of 0.5% in the analyzed CO1 fragment supports the view that <italic>H. canariensis </italic>is indeed native to Tenerife and not introduced from another locality. This is further supported by the very specific habitat of the species. Invasive species often show a low genetic diversity due to the founder effect or a higher genetic distance than native populations when multiple introductions occur (e.g. <xref ref-type="bibr" rid="ref88">Tsutsui <italic>et al., </italic>2000</xref>; <xref rid="ref1" ref-type="bibr">Allendorf &amp; Lundquist, 2003</xref>; <xref ref-type="bibr" rid="ref71">Peacock <italic>et al., </italic>2009</xref>; <xref rid="ref32" ref-type="bibr">Estoup &amp; Guillemaud, 2010</xref>). Genetic analyses could be used in future studies for a better understanding of the biogeography of <italic>Hirudicryptus canariensis, </italic>as the species is distributed on the volcanic Canary Islands Tenerife and La Gomera, and on the ca. 450 km distant Madeira.</p>
    </sec>
  </body>
  <back>
    <ack>
      <title>Acknowledgement</title>
      <p>We express our gratitude to Prof. del Arco Aguilar from the Departamento de Biologia Vegetal of the Universidad de La Laguna (La Laguna, Santa Cruz de Tenerife, Spain) for the identification of <italic>Erica platycodon </italic>and his advice for finding suitable locations of this plant. We thank the Servicio Administrativo de Medio Ambiente y Seguridad of the Cabildo de Tenerife for granting collection permits for the studied areas. We are grateful to Claudia Etzbauer for DNA extraction and to Juliane Vehof (ZFMK) for obtaining photographs of <italic>H. canariensis </italic>in ethanol (<xref ref-type="fig" rid="fig7">Fig. 7</xref>). Furthermore, we thank the hikers and pedestrians, who helped us to orient in the field and pointed us towards interesting spots for observing and collecting. We are grateful to Henrik Enghoff (Natural History Museum of Denmark) for discussions and advice, and the review of this articles, as well as to Sergei Golovatch (Russian Academy of Science) for review of the manuscript and helpful comments. We thank Kerstin Moritz for help in translating Spanish literature and in applying for collecting permits. We thank Antonio Parra G&#243;mez and Kerstin Moritz for help in translating the abstract and captions into Spanish. We are grateful to Brita and Helge Pietsch for accommodation and transportation.</p>
    </ack>
    <ref-list id="refl1">
		<title>References</title>
		<ref id="ref1">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Allendorf</surname>
						<given-names>F.W.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Lundquist</surname>
						<given-names>L.L.</given-names>
					</string-name>
				</person-group>
				<year>2003</year>
				<article-title>Introduction: population biology, evolution, and control of invasive species</article-title>
				<source>Conservation Biology</source>
				<volume>17</volume>
				<issue>1</issue>
				<fpage>24</fpage>
				<lpage>30</lpage>
				<pub-id pub-id-type="doi">10.1046/j.1523-1739.2003.02365.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref2">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Altschul</surname>
						<given-names>S.F.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Gish</surname>
						<given-names>W.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Miller</surname>
						<given-names>W.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Myers</surname>
						<given-names>E.W.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Lipman</surname>
						<given-names>D.J.</given-names>
					</string-name>
				</person-group>
				<year>1990</year>
				<article-title>Basic local alignment search tool</article-title>
				<source>Journal of Molecular Biology</source>
				<volume>215</volume>
				<issue>3</issue>
				<fpage>403</fpage>
				<lpage>410</lpage>
				<pub-id pub-id-type="doi">10.1016/S0022-2836(05)80360-2</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref3">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>del Arco Aguilar</surname>
						<given-names>M.J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Gonz&#225;lez-Gonz&#225;lez</surname>
						<given-names>R.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Garz&#243;n-Machado</surname>
						<given-names>V.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Pizarro-Hern&#225;ndez</surname>
						<given-names>B.</given-names>
					</string-name>
				</person-group>
				<year>2010</year>
				<article-title>Actual and potential natural vegetation on the Canary Islands and its conservation status</article-title>
				<source>Biodiversity and Conservation</source>
				<volume>19</volume>
				<issue>11</issue>
				<fpage>3089</fpage>
				<lpage>3140</lpage>
				<pub-id pub-id-type="doi">10.1007/s10531-010-9881-2</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref4">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Arndt</surname>
						<given-names>E.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Spelda</surname>
						<given-names>J.</given-names>
					</string-name>
				</person-group>
				<year>2008</year>
				<article-title>Millipedes (Diplopoda) of the Canarian Islands: checklist and key</article-title>
				<source>Vieraea</source>
				<volume>36</volume>
				<fpage>1</fpage>
				<lpage>28</lpage>
				<pub-id pub-id-type="doi">10.31939/vieraea.2008.36.01</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref5">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Arozena</surname>
						<given-names>M.E.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Panareda</surname>
						<given-names>J.M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Beltr&#225;n</surname>
						<given-names>E.</given-names>
					</string-name>
				</person-group>
				<year>2008</year>
				<article-title>El significado din&#225;mico de los matorrales de Erica platycodon en las cumbres del Macizo de Anaga, Tenerife (Islas Canarias, Espa&#241;a)</article-title>
				<source>Lazaroa</source>
				<volume>29</volume>
				<fpage>101</fpage>
				<lpage>115</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref6">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Astrin</surname>
						<given-names>J.J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>St&#252;ben</surname>
						<given-names>P.E.</given-names>
					</string-name>
				</person-group>
				<year>2008</year>
				<article-title>Phylogeny in cryptic weevils: molecules, morphology and new genera of western Palaearctic Cryptorhynchinae (Coleoptera : Curculionidae)</article-title>
				<source>Invertebrate Systematics</source>
				<volume>22</volume>
				<issue>5</issue>
				<fpage>503</fpage>
				<lpage>522</lpage>
				<pub-id pub-id-type="doi">10.1071/IS07057</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref7">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Attems</surname>
						<given-names>C.M.T.</given-names>
					</string-name>
				</person-group>
				<year>1909</year>
				<article-title>Die Myriopoden der Vega-Expedition</article-title>
				<source>Arkiv f&#246;r Zoologi</source>
				<volume>5</volume>
				<issue>3</issue>
				<fpage>1</fpage>
				<lpage>84</lpage>
				<pub-id pub-id-type="doi">10.5962/bhl.part.3495</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref8">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Betzin</surname>
						<given-names>A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Thiv</surname>
						<given-names>M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Koch</surname>
						<given-names>M.A.</given-names>
					</string-name>
				</person-group>
				<year>2016</year>
				<article-title>Diversity hotspots of the laurel forest on Tenerife, Canary Islands: a phylogeographic study of Laurus and Ixanthus</article-title>
				<source>Annals of Botany</source>
				<volume>118</volume>
				<issue>3</issue>
				<fpage>495</fpage>
				<lpage>510</lpage>
				<pub-id pub-id-type="doi">10.1093/aob/mcw12416</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref9">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Blanke</surname>
						<given-names>A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Wesener</surname>
						<given-names>T.</given-names>
					</string-name>
				</person-group>
				<year>2014</year>
				<article-title>Revival of forgotten characters and modern imaging techniques help to produce a robust phylogeny of the Diplopoda (Arthropoda, Myriapoda)</article-title>
				<source>Arthropod Structure and Development</source>
				<volume>43</volume>
				<issue>1</issue>
				<fpage>63</fpage>
				<lpage>75</lpage>
				<pub-id pub-id-type="doi">10.1016/j.asd.2013.10.003</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref10">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Brandt</surname>
						<given-names>J.F.</given-names>
					</string-name>
				</person-group>
				<year>1837</year>
				<article-title>Note sur un ordre nouveau de la classe des Myriapodes et sur l&#8217;etablissement des sections de cette classe d&#8217;animaux en g&#233;n&#233;ral</article-title>
				<source>Bulletin Scientifique publi&#233; par l&#8217;Acad&#233;mie Imp&#233;riale des Sciences de Saint-P&#233;tersbourg</source>
				<volume>1</volume>
				<issue>23</issue>
				<fpage>178</fpage>
				<lpage>179</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref11">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Brewer</surname>
						<given-names>M.S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Sierwald</surname>
						<given-names>P.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Bond</surname>
						<given-names>J.E.</given-names>
					</string-name>
				</person-group>
				<year>2012</year>
				<article-title>Millipede taxonomy after 250 years: classification and taxonomic practices in a mega-diverse yet understudied arthropod group</article-title>
				<source>PLoS One</source>
				<volume>7</volume>
				<issue>5</issue>
				<pub-id pub-id-type="publisher-id">e37240</pub-id>
				<pub-id pub-id-type="doi">10.1371/journal.pone.0037240</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref12">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Brolemann</surname>
						<given-names>H.W.</given-names>
					</string-name>
				</person-group>
				<year>1935</year>
				<article-title>Myriapodes Diplopodes (Chilognathes I)</article-title>
				<source>Faune de France</source>
				<volume>29</volume>
				<fpage>1</fpage>
				<lpage>369</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref13">
			<mixed-citation publication-type="book" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Choe</surname>
						<given-names>J.C.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Crespi</surname>
						<given-names>B.J.</given-names>
					</string-name>
				</person-group>
				<year>1997</year>
				<source>The evolution of social behaviour in insects and arachnids</source>
				<publisher-loc>Cambridge</publisher-loc>
				<publisher-name>Cambridge University Press</publisher-name>
				<size units="pages">552</size>
				<pub-id pub-id-type="doi">10.1017/CBO9780511721953</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref14">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Cook</surname>
						<given-names>O.F.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Loomis</surname>
						<given-names>H.F.</given-names>
					</string-name>
				</person-group>
				<year>1928</year>
				<article-title>Millipeds of the order Colobognatha, with descriptions of six new genera and type species, from Arizona and California</article-title>
				<source>Proceedings of the United States National Museum</source>
				<volume>72</volume>
				<fpage>1</fpage>
				<lpage>26</lpage>
				<pub-id pub-id-type="doi">10.5479/si.00963801.72-2714.1</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref15">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Costa</surname>
						<given-names>J. T.</given-names>
					</string-name>
				</person-group>
				<year>2018</year>
				<article-title>The other insect societies: overview and new directions</article-title>
				<source>Current Opinion in Insect Science</source>
				<volume>28</volume>
				<fpage>40</fpage>
				<lpage>49</lpage>
				<pub-id pub-id-type="doi">10.1016/j.cois.2018.04.008</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref16">
			<mixed-citation publication-type="book" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>David</surname>
						<given-names>J.F.</given-names>
					</string-name>
				</person-group>
				<year>2015</year>
				<chapter-title>Diplopoda &#8211; Ecology</chapter-title>
				<person-group person-group-type="editor">
					<string-name name-style="western">
						<surname>Minelli</surname>
						<given-names>A.</given-names>
					</string-name>
				</person-group>
				<source>Treatise on Zoology &#8211; Anatomy, Taxonomy, Biology. The Myriapoda, 2</source>
				<fpage>303</fpage>
				<lpage>327</lpage>
				<publisher-loc>Leiden</publisher-loc>
				<publisher-name>Brill</publisher-name>
				<pub-id pub-id-type="doi">10.1163/9789004188273_013</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref17">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>David</surname>
						<given-names>J.F.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Couret</surname>
						<given-names>T.</given-names>
					</string-name>
				</person-group>
				<year>1983</year>
				<article-title>Le d&#233;veloppement post-embryonnaire en conditions naturelles de Polyzonium germanicum (Brandt)(Diplopoda, Polyzoniida): Les cinq premiers stades</article-title>
				<source>Bulletin du Mus&#233;um national d&#8217;histoire naturelle, Section A, Zoologie, biologie et &#233;cologie animales</source>
				<volume>5</volume>
				<issue>2</issue>
				<fpage>585</fpage>
				<lpage>590</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref18">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>David</surname>
						<given-names>J.F.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Couret</surname>
						<given-names>T.</given-names>
					</string-name>
				</person-group>
				<year>1984</year>
				<article-title>La fin du d&#233;veloppement post-embryonnaire en conditions naturelles de Polyzonium germanicum (Brandt)(Diplopoda, Polyzoniida)</article-title>
				<source>Bulletin du Mus&#233;um national d&#8217;histoire naturelle, Section A, Zoologie, biologie et &#233;cologie animales</source>
				<volume>6</volume>
				<issue>4</issue>
				<fpage>1067</fpage>
				<lpage>1076</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref19">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>David</surname>
						<given-names>J. F.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Couret</surname>
						<given-names>T.</given-names>
					</string-name>
				</person-group>
				<year>1985</year>
				<article-title>Le cycle biologique du diplopode Polyzonium germanicum 22Brandt, 1831 (Polyzoniida)</article-title>
				<source>Revue d&#8216;&#233;cologie et de biologie du sol</source>
				<issue>3</issue>
				<fpage>367</fpage>
				<lpage>380</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref20">
			<mixed-citation publication-type="book"><person-group person-group-type="author"><string-name name-style="western">
						<surname>Dunger</surname><given-names>W.</given-names></string-name>
				</person-group>
				<year>1993</year>
				<chapter-title>&#220;berklasse Antennata (syn. Tracheata, Atelocerata)</chapter-title>
				<person-group person-group-type="editor"><string-name name-style="western">
						<surname>Gruner</surname><given-names>H.-E.</given-names></string-name>
				</person-group><source>Lehrbuch der Speziellen Zoologie</source><part-title>Band I. 4. Teil. Arthropoda (ohne Insecta)</part-title>
				<publisher-loc>Jena</publisher-loc><publisher-name>Gustav Fischer</publisher-name><fpage>1031</fpage><lpage>380</lpage>1160 </mixed-citation>
		</ref>
		<ref id="ref21">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Enderlein</surname>
						<given-names>G.</given-names>
					</string-name>
				</person-group>
				<year>1931</year>
				<article-title>Entomologica Canaria VIII. Aneurus tagasastei, eine neue Aradidae</article-title>
				<source>Zoologischer Anzeiger</source>
				<volume>93</volume>
				<fpage>193</fpage>
				<lpage>198</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref22">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
				</person-group>
				<year>1984</year>
				<article-title>Phylogeny of millipedes - a cladistic analysis</article-title>
				<source>Journal of Zoological Systematics and Evolutionary Research</source>
				<volume>22</volume>
				<issue>1</issue>
				<fpage>8</fpage>
				<lpage>26</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1439-0469.1984.tb00559.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref23">
			<mixed-citation publication-type="paper">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
				</person-group>
				<year>1990</year>
				<article-title>The ground-plan of chilognathan millipedes</article-title>
				<person-group person-group-type="editor">
					<string-name name-style="western">
						<surname>Minelli</surname>
						<given-names>A.</given-names>
					</string-name>
				</person-group>
				<source>Proceeding of the 7th International Congress of Myriapodology</source>
				<conf-name>7th International Congress of Myriapodology</conf-name>
				<conf-date/>
				<conf-loc/>
				<publisher-loc>Leiden</publisher-loc>
				<publisher-name>Brill</publisher-name>
				<fpage>1</fpage>
				<lpage>21</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref24">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
				</person-group>
				<year>1992</year>
				<article-title>Macaronesian millipedes (Diplopoda) with emphasis on endemic species swarms on Madeira and the Canary Islands</article-title>
				<source>Biological Journal of the Linnean Society</source>
				<volume>46</volume>
				<issue>1-2</issue>
				<fpage>153</fpage>
				<lpage>161</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1095-8312.1992.tb00857.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref25">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
				</person-group>
				<year>2010</year>
				<article-title>A new strikingly coloured species of Siphonocryptus, sixth of its order (Diplopoda: Siphonocryptida)</article-title>
				<source>Zootaxa</source>
				<volume>2681</volume>
				<issue>1</issue>
				<fpage>66</fpage>
				<lpage>68</lpage>
				<pub-id pub-id-type="doi">10.11646/zootaxa.2681.1.6</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref26">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
				</person-group>
				<year>2011</year>
				<article-title>Trans-segmental serial colour patterns in millipedes and their developmental interpretation (Diplopoda)</article-title>
				<source>International Journal of Myriapodology</source>
				<volume>6</volume>
				<fpage>1</fpage>
				<lpage>27</lpage>
				<pub-id pub-id-type="doi">10.3897/ijm.6.1949</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref27">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Dohle</surname>
						<given-names>W.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Blower</surname>
						<given-names>J.G.</given-names>
					</string-name>
				</person-group>
				<year>1993</year>
				<article-title>Anamorphosis in millipedes (Diplopoda)&#8212;the present state of knowledge with some developmental and phylogenetic considerations</article-title>
				<source>Zoological Journal of the Linnean Society</source>
				<volume>109</volume>
				<issue>2</issue>
				<fpage>103</fpage>
				<lpage>234</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1096-3642.1993.tb00305.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref28">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Golovatch</surname>
						<given-names>S.I.</given-names>
					</string-name>
				</person-group>
				<year>1995</year>
				<article-title>A revision of the Siphonocryptidae (Diplopoda, Polyzoniida)</article-title>
				<source>Zoologica Scripta</source>
				<volume>24</volume>
				<issue>1</issue>
				<fpage>29</fpage>
				<lpage>41</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1463-6409.1995.tb00473.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref29">
			<mixed-citation publication-type="book" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Golovatch</surname>
						<given-names>S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Short</surname>
						<given-names>M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Stoev</surname>
						<given-names>P.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Wesener</surname>
						<given-names>T.</given-names>
					</string-name>
				</person-group>
				<year>2015</year>
				<chapter-title>Diplopoda &#8211; taxonomic overview</chapter-title>
				<person-group person-group-type="editor">
					<string-name name-style="western">
						<surname>Minelli</surname>
						<given-names>A.</given-names>
					</string-name>
				</person-group>
				<source>Treatise on Zoology &#8211; Anatomy, Taxonomy, Biology. The Myriapoda, 2</source>
				<fpage>363</fpage>
				<lpage>453</lpage>
				<publisher-loc>Leiden</publisher-loc>
				<publisher-name>Brill</publisher-name>
				<pub-id pub-id-type="doi">10.1163/9789004188273_017</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref30">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Reboleira</surname>
						<given-names>A.S.P.S.</given-names>
					</string-name>
				</person-group>
				<year>2017</year>
				<article-title>Diversity of non-Laboulbenialean fungi on millipedes</article-title>
				<source>Studies in Fungi</source>
				<volume>2</volume>
				<issue>1</issue>
				<fpage>130</fpage>
				<lpage>137</lpage>
				<pub-id pub-id-type="doi">10.5943/sif/2/1/15</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref31">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Santamaria</surname>
						<given-names>S.</given-names>
					</string-name>
				</person-group>
				<year>2015</year>
				<article-title>Infectious intimacy and contaminated caves &#8211; three new species of ectoparasitic fungi (Ascomycota: Laboulbeniales) from blaniulid millipedes (Diplopoda: Julida) and inferences about their transmittal mechanisms</article-title>
				<source>Organisms Diversity and Evolution</source>
				<volume>15</volume>
				<issue>2</issue>
				<fpage>249</fpage>
				<lpage>263</lpage>
				<pub-id pub-id-type="doi">10.1007/s13127-015-0208-8</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref32">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Estoup</surname>
						<given-names>A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Guillemaud</surname>
						<given-names>T.</given-names>
					</string-name>
				</person-group>
				<year>2010</year>
				<article-title>Reconstructing routes of invasion using genetic data: why, how and so what?</article-title>
				<source>Molecular Ecology</source>
				<volume>19</volume>
				<fpage>4113</fpage>
				<lpage>4130</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1365-294X.2010.04773.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref33">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Fag&#250;ndez</surname>
						<given-names>J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Juan</surname>
						<given-names>R.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Fern&#225;ndez</surname>
						<given-names>I.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Pastor</surname>
						<given-names>J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Izco</surname>
						<given-names>J.</given-names>
					</string-name>
				</person-group>
				<year>2009</year>
				<article-title>Systematic relevance of seed coat anatomy in the European heathers (Ericeae, Ericaceae)</article-title>
				<source>Plant Systematics and Evolution</source>
				<volume>284</volume>
				<issue>1-2</issue>
				<fpage>65</fpage>
				<lpage>76</lpage>
				<pub-id pub-id-type="doi">10.1007/s00606-009-0240-2</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref34">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Fanzago</surname>
						<given-names>F.</given-names>
					</string-name>
				</person-group>
				<year>1874</year>
				<article-title>Sui Chilognati Italiani</article-title>
				<source>Atti della Societ&#224; Veneto-Trentina di Scienze Naturali</source>
				<volume>3</volume>
				<issue>2</issue>
				<fpage>233</fpage>
				<lpage>292</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref35">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Fern&#225;ndez-Palacios</surname>
						<given-names>J.M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>de Nascimento</surname>
						<given-names>L.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Otto</surname>
						<given-names>R.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Delgado</surname>
						<given-names>J.D.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Garc&#237;a-del-Rey</surname>
						<given-names>E.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Ar&#233;valo</surname>
						<given-names>J.R.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Whittaker</surname>
						<given-names>R.J.</given-names>
					</string-name>
				</person-group>
				<year>2011</year>
				<article-title>A reconstruction of Palaeo-Macaronesia, with particular reference to the long-term biogeography of the Atlantic island laurel forests</article-title>
				<source>Journal of Biogeography</source>
				<volume>38</volume>
				<issue>2</issue>
				<fpage>226</fpage>
				<lpage>246</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1365-2699.2010.02427.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref36">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Fern&#225;ndez-Palacios</surname>
						<given-names>J.M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Whittaker</surname>
						<given-names>R.J.</given-names>
					</string-name>
				</person-group>
				<year>2008</year>
				<article-title>The Canaries: an important biogeographic meeting place</article-title>
				<source>Journal of Biogeography</source>
				<volume>35</volume>
				<fpage>379</fpage>
				<lpage>387</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1365-2699.2008.01890.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref37">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Gardner</surname>
						<given-names>M.R.</given-names>
					</string-name>
				</person-group>
				<year>1974</year>
				<article-title>Revision of the millipede family Andrognathidae in the Nearctic region</article-title>
				<source>Memoirs of the Pacific Coast Entomological Society</source>
				<volume>5</volume>
				<fpage>1</fpage>
				<lpage>61</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref38">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Geldmacher</surname>
						<given-names>J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>van den Bogaard</surname>
						<given-names>P.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Hoernle</surname>
						<given-names>K.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Schmincke</surname>
						<given-names>H.U.</given-names>
					</string-name>
				</person-group>
				<year>2000</year>
				<article-title>The 40Ar/39Ar age dating of the Madeira Archipelago and hotspot track (eastern North Atlantic)</article-title>
				<source>Geochemistry, Geophysics, Geosystems</source>
				<volume>1</volume>
				<issue>1</issue>
				<fpage>1</fpage>
				<lpage>26</lpage>
				<pub-id pub-id-type="doi">10.1029/1999GC000018</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref39">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Geldmacher</surname>
						<given-names>J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Hoernle</surname>
						<given-names>K.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Bogaard</surname>
						<given-names>P.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Duggen</surname>
						<given-names>S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Werner</surname>
						<given-names>R.</given-names>
					</string-name>
				</person-group>
				<year>2005</year>
				<article-title>New 40Ar/39Ar age and geochemical data from seamounts in the Canary and Madeira volcanic provinces: support for the mantle plume hypothesis</article-title>
				<source>Earth and Planetary Science Letters</source>
				<volume>237</volume>
				<issue>1-2</issue>
				<fpage>85</fpage>
				<lpage>101</lpage>
				<pub-id pub-id-type="doi">10.1016/j.epsl.2005.04.037</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref40">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Golovatch</surname>
						<given-names>S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Evsyukov</surname>
						<given-names>A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Reip</surname>
						<given-names>H.S.</given-names>
					</string-name>
				</person-group>
				<year>2015</year>
				<article-title>Colobog&#172;natha millipedes in the Caucasus (Diplopoda: Polyzoni-ida, Platydesmida, Siphonocryptida)</article-title>
				<source>Zootaxa</source>
				<volume>3972</volume>
				<issue>2</issue>
				<fpage>250</fpage>
				<lpage>266</lpage>
				<pub-id pub-id-type="doi">10.11646/zootaxa.3972.2.6</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref41">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Golovatch</surname>
						<given-names>S.I.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Kime</surname>
						<given-names>R.D.</given-names>
					</string-name>
				</person-group>
				<year>2009</year>
				<article-title>Millipede (Diplopoda) distributions: A review</article-title>
				<source>Soil Organisms</source>
				<volume>81</volume>
				<issue>3</issue>
				<fpage>565</fpage>
				<lpage>597</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref42">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Gonz&#225;lez-Montelongo</surname>
						<given-names>C.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>P&#233;rez-Vargas</surname>
						<given-names>I.</given-names>
					</string-name>
				</person-group>
				<year>2019</year>
				<article-title>Looking for a home: Exploring the potential of epiphytic lichens to colonize tree plantations in a Macaronesian laurel forest</article-title>
				<source>Forest Ecology and Management</source>
				<volume>453</volume>
				<pub-id pub-id-type="doi">10.1016/j.foreco.2019.117541</pub-id>
				<pub-id pub-id-type="publisher-id">117541</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref43">
			<mixed-citation publication-type="database">
				<collab>Government of the Canary Islands</collab>
				<source>Biodiversity Data Bank of the Canary Islands</source>
				<comment>Disponible en: <ext-link xlink:href="http://www.biodiversidadcanarias.es/biota" ext-link-type="uri">http://www.biodiversidadcanarias.es/biota</ext-link></comment>
				<date-in-citation content-type="access-date">14-03-2022</date-in-citation>
			</mixed-citation>
		</ref>
		<ref id="ref44">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Hall</surname>
						<given-names>T.A.</given-names>
					</string-name>
				</person-group>
				<year>1999</year>
				<article-title>BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT</article-title>
				<source>Nucleic Acids Sympsoium</source>
				<volume>41</volume>
				<fpage>95</fpage>
				<lpage>98</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref45">
			<mixed-citation publication-type="book">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Hansen</surname>
						<given-names>A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Kunkel</surname>
						<given-names>G.</given-names>
					</string-name>
				</person-group>
				<year>1976</year>
				<chapter-title>Erica scoparia subsp. platycodon comb. nova</chapter-title>
				<person-group person-group-type="editor">
					<string-name name-style="western">
						<surname>Kunkel</surname>
						<given-names>G.</given-names>
					</string-name>
				</person-group>
				<source>Gran Canaria, Tenerife y La Gomera: notas floristicas y adiciones</source>
				<series>Cuadernos botanicos canarios</series>
				<volume>26-27</volume>
				<fpage>79</fpage>
				<lpage>80</lpage>
				<publisher-name>Las Palmas</publisher-name>
			</mixed-citation>
		</ref>
		<ref id="ref46">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Hoffman</surname>
						<given-names>R.L.</given-names>
					</string-name>
				</person-group>
				<year>1977</year>
				<article-title>On the status of Siphonotus brasiliensis Brandt, and the diplopod family Siphonotidae (Polyzoniida)</article-title>
				<source>Deutsche Entomologische Zeitschrift</source>
				<volume>24</volume>
				<issue>4-5</issue>
				<fpage>425</fpage>
				<lpage>431</lpage>
				<pub-id pub-id-type="doi">10.1002/mmnd.4800240418</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref47">
			<mixed-citation publication-type="book">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Hoffman</surname>
						<given-names>R.L.</given-names>
					</string-name>
				</person-group>
				<year>1980</year>
				<source>Classification of the Diplopoda</source>
				<publisher-loc>Gen&#232;ve</publisher-loc>
				<publisher-name>Museum d&#8217;Histoire Naturelle</publisher-name>
				<size units="pages">237</size>
			</mixed-citation>
		</ref>
		<ref id="ref48">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Joly</surname>
						<given-names>F.X.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Coq</surname>
						<given-names>S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Coulis</surname>
						<given-names>M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>David</surname>
						<given-names>J.F.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>H&#228;ttenschwiler</surname>
						<given-names>S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Mueller</surname>
						<given-names>C.W.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Prater</surname>
						<given-names>I.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Subke</surname>
						<given-names>J.A.</given-names>
					</string-name>
				</person-group>
				<year>2020</year>
				<article-title>Detritivore conversion of litter into faeces accelerates organic matter turnover</article-title>
				<source>Communications Biology</source>
				<volume>3</volume>
				<pub-id pub-id-type="doi">10.1038/s42003-020-01392-4</pub-id>
				<pub-id pub-id-type="publisher-id">660</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref49">
			<mixed-citation publication-type="book" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Koch</surname>
						<given-names>M.</given-names>
					</string-name>
				</person-group>
				<year>2015</year>
				<chapter-title>Diplopoda &#8211; general morphology</chapter-title>
				<person-group person-group-type="editor">
					<string-name name-style="western">
						<surname>Minelli</surname>
						<given-names>A.</given-names>
					</string-name>
				</person-group>
				<source>Treatise on Zoology &#8211; Anatomy, Taxonomy, Biology. The Myriapoda, 2</source>
				<fpage>7</fpage>
				<lpage>67</lpage>
				<publisher-loc>Leiden</publisher-loc>
				<publisher-name>Brill</publisher-name>
				<pub-id pub-id-type="doi">10.1163/9789004188273_003</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref50">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Kors&#243;s</surname>
						<given-names>Z.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Chang</surname>
						<given-names>H.W.</given-names>
					</string-name>
				</person-group>
				<year>2008</year>
				<article-title>A most unusual animal distribution pattern: A new siphonocryptid millipede from Taiwan (Diplopoda, Siphonocryptida)</article-title>
				<source>Acta Zoologica Academiae Scientiarum Hungaricae</source>
				<volume>54</volume>
				<issue>2</issue>
				<fpage>151</fpage>
				<lpage>157</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref51">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Kors&#243;s</surname>
						<given-names>Z.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Geoffroy</surname>
						<given-names>J.J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Mauri&#232;s</surname>
						<given-names>J.P.</given-names>
					</string-name>
				</person-group>
				<year>2009</year>
				<article-title>The fifth element: reconnection of the disjunct distribution of the members of Siphonocryptida (Diplopoda) with the description of a new species from Nepal</article-title>
				<source>Journal of Natural History</source>
				<volume>43</volume>
				<issue>7-8</issue>
				<fpage>435</fpage>
				<lpage>445</lpage>
				<pub-id pub-id-type="doi">10.1080/00222930802610428</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref52">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Kudo</surname>
						<given-names>S.I.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Akagi</surname>
						<given-names>Y.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Hiraoka</surname>
						<given-names>S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Tanabe</surname>
						<given-names>T.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Morimoto</surname>
						<given-names>G.</given-names>
					</string-name>
				</person-group>
				<year>2011</year>
				<article-title>Exclusive male egg care and determinants of brooding success in a millipede</article-title>
				<source>Ethology</source>
				<volume>117</volume>
				<issue>1</issue>
				<fpage>19</fpage>
				<lpage>27</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1439-0310.2010.01851.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref53">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Kudo</surname>
						<given-names>S.I.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Koshio</surname>
						<given-names>C.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Tanabe</surname>
						<given-names>T.</given-names>
					</string-name>
				</person-group>
				<year>2009</year>
				<article-title>Male egg-brooding in the millipede Yamasinaium noduligerum (Diplopoda: Andrognathidae)</article-title>
				<source>Entomological Science</source>
				<volume>12</volume>
				<issue>3</issue>
				<fpage>346</fpage>
				<lpage>347</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1479-8298.2009.00331.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref54">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Lewis</surname>
						<given-names>S.G.</given-names>
					</string-name>
				</person-group>
				<year>1984</year>
				<article-title>Notes on the biology of some common millipedes of the Gunung Mulu National Park, Sarawak, Borneo</article-title>
				<source>The Sarawak Museum Journal</source>
				<volume>33</volume>
				<issue>54</issue>
				<fpage>179</fpage>
				<lpage>185</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref55">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Liu</surname>
						<given-names>W.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>R&#252;hr</surname>
						<given-names>P.T.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Wesener</surname>
						<given-names>T.</given-names>
					</string-name>
				</person-group>
				<year>2017</year>
				<article-title>A look with &#956;CT technology into a treasure trove of fossils: The first two fossils of the millipede order Siphoniulida discovered in Cretaceous Burmese amber (Myriapoda, Diplopoda)</article-title>
				<source>Cretaceous Research</source>
				<volume>74</volume>
				<fpage>100</fpage>
				<lpage>108</lpage>
				<pub-id pub-id-type="doi">10.1016/j.cretres.2017.01.009</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref56">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Loksa</surname>
						<given-names>I.</given-names>
					</string-name>
				</person-group>
				<year>1967</year>
				<article-title>Diplopoden aus den Sammlungen von Prof. Dr. H. Franz auf den Kanarischen Inseln</article-title>
				<source>Opuscula Zoologica</source>
				<volume>7</volume>
				<issue>1</issue>
				<fpage>133</fpage>
				<lpage>145</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref57">
			<mixed-citation publication-type="book" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Machado</surname>
						<given-names>A.</given-names>
					</string-name>
				</person-group>
				<year>1976</year>
				<chapter-title>Introduction to a faunal study of the Canary Islands&#8217; laurisilva, with special reference to the ground-beetles</chapter-title>
				<person-group person-group-type="editor">
					<string-name name-style="western">
						<surname>Kungel</surname>
						<given-names>G.</given-names>
					</string-name>
				</person-group>
				<source>Biogeography and ecology in the Canary Islands</source>
				<fpage>367</fpage>
				<lpage>411</lpage>
				<publisher-loc>Heidelberg</publisher-loc>
				<publisher-name>Springer</publisher-name>
				<pub-id pub-id-type="doi">10.1007/978-94-010-1566-0_13</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref58">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Macias</surname>
						<given-names>A.M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Marek</surname>
						<given-names>P.E.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Morrissey</surname>
						<given-names>E.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Brewer</surname>
						<given-names>M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Short</surname>
						<given-names>D.G.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Stauder</surname>
						<given-names>C.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Wickert</surname>
						<given-names>K.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Berger</surname>
						<given-names>M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Metheny</surname>
						<given-names>A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Stajich</surname>
						<given-names>J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Boyce</surname>
						<given-names>G.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Rio</surname>
						<given-names>R.M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Panaccione</surname>
						<given-names>D.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Wong</surname>
						<given-names>V.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Jones</surname>
						<given-names>T.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Kasson</surname>
						<given-names>M.</given-names>
					</string-name>
				</person-group>
				<year>2019</year>
				<article-title>Diversity and function of fungi associated with the fungivorous millipede, Brachycybe lecontii</article-title>
				<source>Fungal Ecology</source>
				<volume>41</volume>
				<fpage>187</fpage>
				<lpage>197</lpage>
				<pub-id pub-id-type="doi">10.1016/j.funeco.2019.06.006</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref59">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Manton</surname>
						<given-names>S.M.</given-names>
					</string-name>
				</person-group>
				<year>1961</year>
				<article-title>The evolution of arthropodan locomotory mechanisms. Part 7. Functional requirements and body design in Colobognatha (Diplopoda), together with a comparative account of diplopod burrowing techniques, trunk musculature and segmentation</article-title>
				<source>Zoological Journal of the Linnean Society</source>
				<volume>44</volume>
				<fpage>383</fpage>
				<lpage>462</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1096-3642.1961.tb01622.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref60">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Marek</surname>
						<given-names>P.E.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Buzatto</surname>
						<given-names>B.A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Shear</surname>
						<given-names>W.A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Means</surname>
						<given-names>J.C.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Black</surname>
						<given-names>D.G.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Harvey</surname>
						<given-names>M.S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Rodriguez</surname>
						<given-names>J.</given-names>
					</string-name>
				</person-group>
				<year>2021</year>
				<article-title>The first true millipede&#8212;1306 legs long</article-title>
				<source>Scientific reports</source>
				<volume>11</volume>
				<issue>1</issue>
				<fpage>1</fpage>
				<lpage>8</lpage>
				<pub-id pub-id-type="doi">10.1038/s41598-021-02447-0</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref61">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>McClintock</surname>
						<given-names>D.C.</given-names>
					</string-name>
				</person-group>
				<year>1989</year>
				<article-title>The Erica scoparia in Madeira</article-title>
				<source>Heather Society Yearbook</source>
				<fpage>32</fpage>
				<lpage>36</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref62">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Minelli</surname>
						<given-names>A.</given-names>
					</string-name>
				</person-group>
				<year>1981</year>
				<article-title>Le strategie riproduttive di alcuni artropodi di fagetta</article-title>
				<source>Natura e Montagna</source>
				<volume>28</volume>
				<issue>4</issue>
				<fpage>74</fpage>
				<lpage>76</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref63">
			<mixed-citation publication-type="book" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Minelli</surname>
						<given-names>A.</given-names>
					</string-name>
				</person-group>
				<year>2015</year>
				<chapter-title>Diplopoda &#8211; development</chapter-title>
				<person-group person-group-type="editor">
					<string-name name-style="western">
						<surname>Minelli</surname>
						<given-names>A.</given-names>
					</string-name>
				</person-group>
				<source>Treatise on Zoology &#8211; Anatomy, Taxonomy, Biology. The Myriapoda, 2</source>
				<fpage>267</fpage>
				<lpage>302</lpage>
				<publisher-loc>Leiden</publisher-loc>
				<publisher-name>Brill</publisher-name>
				<pub-id pub-id-type="doi">10.1163/9789004188273_012</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref64">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Morales</surname>
						<given-names>D.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Jim&#233;nez</surname>
						<given-names>M.S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Gonz&#225;lez-Rodr&#237;guez</surname>
						<given-names>A.M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>&#268;erm&#225;k</surname>
						<given-names>J.</given-names>
					</string-name>
				</person-group>
				<year>1996</year>
				<article-title>Laurel forests in Tenerife, Canary Islands</article-title>
				<source>Trees</source>
				<volume>11</volume>
				<issue>1</issue>
				<fpage>34</fpage>
				<lpage>40</lpage>
				<pub-id pub-id-type="doi">10.1007/s004680050055</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref65">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Moritz</surname>
						<given-names>L.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Blanke</surname>
						<given-names>A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Hammel</surname>
						<given-names>J.U.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Thomas</surname>
						<given-names>W.</given-names>
					</string-name>
				</person-group>
				<year>2021</year>
				<article-title>First steps toward suctorial feeding in millipedes: Comparative morphology of the head of the Platydesmida (Diplopoda: Colobognatha)</article-title>
				<source>Invertebrate Biology</source>
				<volume>140</volume>
				<issue>2</issue>
				<pub-id pub-id-type="publisher-id">e12312</pub-id>
				<pub-id pub-id-type="doi">10.1111/ivb.12312</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref66">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Moritz</surname>
						<given-names>L.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Borisova</surname>
						<given-names>E.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Hammel</surname>
						<given-names>J.U.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Blanke</surname>
						<given-names>A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Wesener</surname>
						<given-names>T.</given-names>
					</string-name>
				</person-group>
				<year>2022</year>
				<article-title>A previously unknown feeding mode in millipedes and the convergence of fluid feeding across arthropods</article-title>
				<source>Science Advances</source>
				<volume>8</volume>
				<issue>7</issue>
				<pub-id pub-id-type="publisher-id">eabm0577</pub-id>
				<pub-id pub-id-type="doi">10.1126/sciadv.abm0577</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref67">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Murakami</surname>
						<given-names>Y.</given-names>
					</string-name>
				</person-group>
				<year>1962a</year>
				<article-title xml:lang="ja">Postembryonic development of the common Myriapoda of Japan XI. Life history of Bazillozonium nodulosum Verhoeff (Corobognatha, Platydesmidae) 1</article-title>
				<source xml:lang="ja">Zoological Magazine (Dobutsugaku Zasshi)</source>
				<volume>71</volume>
				<fpage>250</fpage>
				<lpage>255</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref68">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Murakami</surname>
						<given-names>Y.</given-names>
					</string-name>
				</person-group>
				<year>1962b</year>
				<article-title xml:lang="ja">Postembryonic development of the common Myriapoda of Japan XII. Life history of Bazillozonium nodulosum Verhoeff (Corobognatha, Platydesmidae) 2</article-title>
				<source xml:lang="ja">Zoological Magazine (Dobutsugaku Zasshi)</source>
				<volume>71</volume>
				<fpage>291</fpage>
				<lpage>294</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref69">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Murakami</surname>
						<given-names>Y.</given-names>
					</string-name>
				</person-group>
				<year>1963</year>
				<article-title xml:lang="ja">Postembryonic development of the common Myriapoda of Japan XI. Life history of Bazillozonium nodulosum Verhoeff (Corobognatha, Platydesmidae) 3</article-title>
				<source xml:lang="ja">Zoological Magazine (Dobutsugaku Zasshi)</source>
				<volume>72</volume>
				<fpage>40</fpage>
				<lpage>47</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref70">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Nascimento</surname>
						<given-names>L. de</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Willis</surname>
						<given-names>K.J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Fern&#225;ndez-Palacios</surname>
						<given-names>J.M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Criado</surname>
						<given-names>C.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Whittaker</surname>
						<given-names>R.J.</given-names>
					</string-name>
				</person-group>
				<year>2009</year>
				<article-title>The long-term ecology of the lost forests of La Laguna, Tenerife (Canary Islands)</article-title>
				<source>Journal of Biogeography</source>
				<volume>36</volume>
				<issue>3</issue>
				<fpage>499</fpage>
				<lpage>514</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1365-2699.2008.02012.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref71">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Peacock</surname>
						<given-names>M.M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Beard</surname>
						<given-names>K.H.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>O&#8217;Neill</surname>
						<given-names>E.M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Kirchoff</surname>
						<given-names>V.S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Peters</surname>
						<given-names>M.B.</given-names>
					</string-name>
				</person-group>
				<year>2009</year>
				<article-title>Strong founder effects and low genetic diversity in introduced populations of Coqui frogs</article-title>
				<source>Molecular Ecology</source>
				<volume>18</volume>
				<issue>17</issue>
				<fpage>3603</fpage>
				<lpage>3615</lpage>
				<pub-id pub-id-type="doi">10.1111/j.1365-294X.2009.04308.x</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref72">
			<mixed-citation publication-type="book" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Pocock</surname>
						<given-names>R.I,</given-names>
					</string-name>
				</person-group>
				<year>1894</year>
				<chapter-title>Chilopoda, Symphyla and Diplopoda from the Malay Archipelago</chapter-title>
				<person-group person-group-type="editor">
					<string-name name-style="western">
						<surname>Weber</surname>
						<given-names>M.</given-names>
					</string-name>
				</person-group>
				<source>Zoologische Ergebnisse einer Reise in Niederl&#228;ndisch Ost-Indien</source>
				<volume>Band 3</volume>
				<fpage>307</fpage>
				<lpage>404</lpage>
				<publisher-loc>Leiden</publisher-loc>
				<publisher-name>Brill</publisher-name>
				<pub-id pub-id-type="doi">10.5962/bhl.title.52289</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref73">
			<mixed-citation publication-type="web-page" publication-format="web">
				<year>2022</year>
				<source>Plants of the World Online</source>
				<publisher-name>Royal Botanic Gardens, Kew</publisher-name>
				<comment>Disponible en: <ext-link xlink:href="http://www.plantsoftheworldonline.org/" ext-link-type="uri">http://www.plantsoftheworldonline.org/</ext-link></comment>
				<date-in-citation content-type="access-date">14-03-2022</date-in-citation>
			</mixed-citation>
		</ref>
		<ref id="ref74">
			<mixed-citation publication-type="web-page" publication-format="web">
				<collab>QGIS Development Team</collab>
				<year>2019</year>
				<source>QGIS Geographic Information System</source>
				<publisher-name>Open Source Geospatial Foundation Project</publisher-name>
				<comment>Disponible en: <ext-link xlink:href="http://qgis.osgeo.org" ext-link-type="uri">http://qgis.osgeo.org</ext-link></comment>
			</mixed-citation>
		</ref>
		<ref id="ref75">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Read</surname>
						<given-names>H.J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
				</person-group>
				<year>2009</year>
				<article-title>The order Siphonophorida&#8211;A taxonomist&#8217;s nightmare? Lessons from a Brazilian collection</article-title>
				<source>Soil Organisms</source>
				<volume>81</volume>
				<issue>3</issue>
				<fpage>543</fpage>
				<lpage>556</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref76">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Read</surname>
						<given-names>H.J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
				</person-group>
				<year>2018</year>
				<article-title>Siphonophoridae from Brazilian Amazonia Part 1&#8211;The genus Columbianum Verhoeff, 1941 (Diplopoda, Siphonophorida)</article-title>
				<source>European Journal of Taxonomy</source>
				<volume>477</volume>
				<fpage>1</fpage>
				<lpage>23</lpage>
				<pub-id pub-id-type="doi">10.5852/ejt.2018.477</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref77">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Reip</surname>
						<given-names>H.S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Wesener</surname>
						<given-names>T.</given-names>
					</string-name>
				</person-group>
				<year>2018</year>
				<article-title>Intraspecific variation and phylogeography of the millipede model organism, the Black Pill Millipede Glomeris marginata (Villers, 1789) (Diplopoda, Glomerida, Glomeridae)</article-title>
				<source>ZooKeys</source>
				<volume>741</volume>
				<fpage>93</fpage>
				<lpage>131</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref78">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Ribaut</surname>
						<given-names>H.</given-names>
					</string-name>
				</person-group>
				<year>1908</year>
				<article-title>Notes Myriopodologiques IV</article-title>
				<source>Bulletin de la Soci&#233;t&#233; d&#8217;histoire naturelle de Toulouse</source>
				<volume>41</volume>
				<fpage>99</fpage>
				<lpage>108</lpage>
				<pub-id pub-id-type="doi">10.5962/bhl.part.5607</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref79">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Rimsky-Korsakow</surname>
						<given-names>M.</given-names>
					</string-name>
				</person-group>
				<year>1895</year>
				<article-title>Ueber Polyzonium germani&#172;cum Brandt</article-title>
				<source>Trudy Sankt-Peterburgskogo Obshchestva Estestvoispytatelei, Otdelenie Zoologii i Fiziologii</source>
				<volume>25</volume>
				<issue>2</issue>
				<fpage>21</fpage>
				<lpage>33</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref80">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Rivas-Mart&#237;nez</surname>
						<given-names>S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Wildpret de la Torre</surname>
						<given-names>W.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>del Arco Aguilar</surname>
						<given-names>M.J.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Rodriguez Delgado</surname>
						<given-names>O.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>P&#233;rez de Paz</surname>
						<given-names>P.L.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Garc&#237;a Gallo</surname>
						<given-names>A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Acebes Ginov&#233;s</surname>
						<given-names>J.R.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>D&#237;az Gonz&#225;lez</surname>
						<given-names>T.E.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Fern&#225;ndez Gonz&#225;lez</surname>
						<given-names>F.</given-names>
					</string-name>
				</person-group>
				<year>1993</year>
				<article-title>Las comunidades vegetales de la Isla de Tenerife (Islas Canarias)</article-title>
				<source>Itinera Geobotanica</source>
				<volume>7</volume>
				<fpage>169</fpage>
				<lpage>374</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref81">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Santamaria</surname>
						<given-names>S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Reboleira</surname>
						<given-names>A.S.P.S.</given-names>
					</string-name>
				</person-group>
				<year>2014</year>
				<article-title>Laboulbeniales on millipedes: the genera Diplopodomyces and Troglomyces</article-title>
				<source>Mycologia</source>
				<volume>106</volume>
				<issue>5</issue>
				<fpage>1027</fpage>
				<lpage>1038</lpage>
				<pub-id pub-id-type="doi">10.3852/13-381</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref82">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Santamaria</surname>
						<given-names>S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Reboleira</surname>
						<given-names>A.S.P.S.</given-names>
					</string-name>
				</person-group>
				<year>2016</year>
				<article-title>Hidden biodiversity revealed by collections based research &#8211; Laboulbeniales in millipedes: genus Rickia</article-title>
				<source>Phytotaxa</source>
				<volume>243</volume>
				<issue>2</issue>
				<fpage>101</fpage>
				<lpage>127</lpage>
				<pub-id pub-id-type="doi">10.11646/phytotaxa.243.2.1</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref83">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Sierwald</surname>
						<given-names>P.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Bond</surname>
						<given-names>J.E.</given-names>
					</string-name>
				</person-group>
				<year>2007</year>
				<article-title>Current Status of the Myriapod Class Diplopoda (Millipedes): Taxonomic Diversity and Phylogeny</article-title>
				<source>Annual Review of Entomology</source>
				<volume>52</volume>
				<fpage>401</fpage>
				<lpage>420</lpage>
				<pub-id pub-id-type="doi">10.1146/annurev.ento.52.111805.090210</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref84">
			<mixed-citation publication-type="paper">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Silvestri</surname>
						<given-names>F.</given-names>
					</string-name>
				</person-group>
				<year>1950</year>
				<article-title>Segmentazione del corpo dei colobognati (Diplopodi)</article-title>
				<person-group person-group-type="editor">
					<string-name name-style="western">
						<surname>Elfstr&#246;ms Boktryckeri</surname>
						<given-names>A.F.</given-names>
					</string-name>
				</person-group>
				<source>Proceedings of the Eighth International Congress of Entomology</source>
				<conf-name>Eighth International Congress of Entomology</conf-name>
				<conf-date/>
				<conf-loc/>
				<publisher-loc>Stockholm</publisher-loc>
				<fpage>571</fpage>
				<lpage>576</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref85">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Shelley</surname>
						<given-names>R.M.</given-names>
					</string-name>
				</person-group>
				<year>2003</year>
				<article-title>A revised, annotated, family-level classification of the Diplopoda</article-title>
				<source>Arthropoda Selecta</source>
				<volume>11</volume>
				<issue>3</issue>
				<fpage>187</fpage>
				<lpage>207</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref86">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Shorter</surname>
						<given-names>P.L.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Hennen</surname>
						<given-names>D.A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Marek</surname>
						<given-names>P.E.</given-names>
					</string-name>
				</person-group>
				<year>2018</year>
				<article-title>Cryptic diversity in Andrognathus corticarius Cope, 1869 and description of a new Andrognathus species from New Mexico (Diplopoda, Platydesmida, Andrognathidae)</article-title>
				<source>ZooKeys</source>
				<volume>786</volume>
				<fpage>19</fpage>
				<lpage>41</lpage>
				<pub-id pub-id-type="doi">10.3897/zookeys.786.27631</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref87">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Tamura</surname>
						<given-names>K.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Stecher</surname>
						<given-names>G.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Peterson</surname>
						<given-names>D.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Filipski</surname>
						<given-names>A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Kumar</surname>
						<given-names>S.</given-names>
					</string-name>
				</person-group>
				<year>2013</year>
				<article-title>MEGA6: molecular evolutionary genetics analysis version 6.0</article-title>
				<source>Molecular biology and evolution</source>
				<volume>30</volume>
				<issue>12</issue>
				<fpage>2725</fpage>
				<lpage>2729</lpage>
				<pub-id pub-id-type="doi">10.1093/molbev/mst197</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref88">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Tsutsui</surname>
						<given-names>N.D.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Suarez</surname>
						<given-names>A.V.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Holway</surname>
						<given-names>D.A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Case</surname>
						<given-names>T.J.</given-names>
					</string-name>
				</person-group>
				<year>2000</year>
				<article-title>Reduced genetic variation and the success of an invasive species</article-title>
				<source>Proceedings of the National Academy of Sciences</source>
				<volume>97</volume>
				<issue>11</issue>
				<pub-id pub-id-type="publisher-id">5948</pub-id>
				<pub-id pub-id-type="doi">10.1073/pnas.100110397</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref89">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Verhoeff</surname>
						<given-names>K.W.</given-names>
					</string-name>
				</person-group>
				<year>1926</year>
				<article-title>&#220;ber einige s&#252;dalpine Chilognathen (102. Diplopoden-Aufsatz.)</article-title>
				<source>Zoologischer Anzeiger</source>
				<volume>66</volume>
				<issue>1-4</issue>
				<fpage>65</fpage>
				<lpage>81</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref90">
			<mixed-citation publication-type="book">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Verhoeff</surname>
						<given-names>K.W.</given-names>
					</string-name>
				</person-group>
				<year>1928</year>
				<chapter-title>Klasse Diplopoda, 1. Teil</chapter-title>
				<person-group person-group-type="editor">
					<string-name name-style="western">
						<surname>Bronns</surname>
						<given-names>H.G.</given-names>
					</string-name>
				</person-group>
				<source>Klassen und Ordnungen des Tierreichs, 5</source>
				<part-title>Band, 2. Abteilung, Gliederf&#252;ssler: Arthropoda</part-title>
				<publisher-loc>Leipzig</publisher-loc>
				<publisher-name>Akademischer Verlag</publisher-name>
				<size units="pages">1071</size>
			</mixed-citation>
		</ref>
		<ref id="ref91">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Verhoeff</surname>
						<given-names>K.W.</given-names>
					</string-name>
				</person-group>
				<year>1935</year>
				<article-title>Neue ostasiatische Colobognathen. 140. Diplopden-Aufsatz</article-title>
				<source>Zoologischer Anzeiger</source>
				<volume>112</volume>
				<issue>3-4</issue>
				<fpage>62</fpage>
				<lpage>73</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref92">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Verhoeff</surname>
						<given-names>K.W.</given-names>
					</string-name>
				</person-group>
				<year>1939</year>
				<article-title>Diplopoden von der Ryukyu-Insel Okinawa</article-title>
				<source>Transactions of Biogeographical Society of Japan</source>
				<volume>3</volume>
				<issue>2</issue>
				<fpage>118</fpage>
				<lpage>122</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref93">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Vicente</surname>
						<given-names>M.C.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Enghoff</surname>
						<given-names>H.</given-names>
					</string-name>
				</person-group>
				<year>1999</year>
				<article-title>The millipedes of the Canary Islands (Myriapoda: Diplopoda).</article-title>
				<source>Vieraea</source>
				<volume>27</volume>
				<fpage>183</fpage>
				<lpage>204</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref94">
			<mixed-citation publication-type="book">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Villers</surname>
						<given-names>C.J. de</given-names>
					</string-name>
				</person-group>
				<year>1789</year>
				<source>Caroli Linnaei Entomologia, faunae Suecicae descriptionibus aucta</source>
				<part-title>Volume 4, Aptera</part-title>
				<size units="pages">556</size>
				<publisher-name>Lugduni</publisher-name>
			</mixed-citation>
		</ref>
		<ref id="ref95">
			<mixed-citation publication-type="book" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Webb</surname>
						<given-names>P.B.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Berthelot</surname>
						<given-names>S.</given-names>
					</string-name>
				</person-group>
				<year>1844</year>
				<source>Histoire Naturelle des &#206;sles Canaries</source>
				<part-title>Tome troisi&#232;me, Phytographia Canariensis, Sectio II</part-title>
				<publisher-loc>Paris</publisher-loc>
				<size units="pages">496</size>
				<pub-id pub-id-type="doi">10.5962/bhl.title.60795</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref96">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Wegensteiner</surname>
						<given-names>R.</given-names>
					</string-name>
				</person-group>
				<year>1982</year>
				<article-title>On the relationship between the ecological potence of Polyzonium germanicum Brandt (Diplopoda, Colobognatha) and the environmental parameters in the Vorderen Rotmoos (Lunz, NO)</article-title>
				<source>Zoologische Jahrb&#252;cher, Abteilung f&#252;r Systematik, &#214;kologie und Geographie der Tiere</source>
				<volume>109</volume>
				<issue>3</issue>
				<fpage>309</fpage>
				<lpage>327</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref97">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Wesener</surname>
						<given-names>T.</given-names>
					</string-name>
				</person-group>
				<year>2015</year>
				<article-title>No millipede endemics north of the Alps? DNA-barcoding reveals Glomeris malmivaga Verhoeff, 1912 as a synonym of G. ornata Koch, 1847 (Diplopoda, Glomerida, Glomeridae)</article-title>
				<source>Zootaxa</source>
				<volume>3999</volume>
				<issue>4</issue>
				<fpage>571</fpage>
				<lpage>580</lpage>
				<pub-id pub-id-type="doi">10.11646/zootaxa.3999.4.7</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref98">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Wong</surname>
						<given-names>V.L.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Hennen</surname>
						<given-names>D.A.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Macias</surname>
						<given-names>A.M.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Brewer</surname>
						<given-names>M.S.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Kasson</surname>
						<given-names>M.T.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Marek</surname>
						<given-names>P.</given-names>
					</string-name>
				</person-group>
				<year>2020</year>
				<article-title>Natural history of the social millipede Brachycybe lecontii Wood, 1864</article-title>
				<source>Biodiversity Data Journal</source>
				<volume>8</volume>
				<pub-id pub-id-type="publisher-id">e50770</pub-id>
				<pub-id pub-id-type="doi">10.3897/BDJ.8.e50770</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref99">
			<mixed-citation publication-type="journal">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Wood</surname>
						<given-names>H.C.</given-names>
					</string-name>
				</person-group>
				<year>1864</year>
				<article-title>Description of new genera and species of North American Myriapoda</article-title>
				<source>Proceedings of the Academy of natural Science of Philadelphia</source>
				<volume>1864</volume>
				<fpage>186</fpage>
				<lpage>187</lpage>
			</mixed-citation>
		</ref>
		<ref id="ref100">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Yip</surname>
						<given-names>E.C.</given-names>
					</string-name>
					<string-name name-style="western">
						<surname>Rayor</surname>
						<given-names>L.S.</given-names>
					</string-name>
				</person-group>
				<year>2014</year>
				<article-title>Maternal care and subsocial behaviour in spiders</article-title>
				<source>Biological Reviews</source>
				<volume>89</volume>
				<issue>2</issue>
				<fpage>427</fpage>
				<lpage>449</lpage>
				<pub-id pub-id-type="doi">10.1111/brv.12060</pub-id>
			</mixed-citation>
		</ref>
		<ref id="ref101">
			<mixed-citation publication-type="journal" publication-format="web">
				<person-group person-group-type="author">
					<string-name name-style="western">
						<surname>Zuev</surname>
						<given-names>R.V.</given-names>
					</string-name>
				</person-group>
				<year>2017</year>
				<article-title>The relict millipede Hirudicryptus abchasicus Golovatch, Evsyukov et Reip, 2015, represents a species, genus, family and order new to the fauna of Russia (Diplopoda: Siphonocryptida: Siphonocryptidae)</article-title>
				<source>Russian Entomological Journal</source>
				<volume>26</volume>
				<issue>3</issue>
				<fpage>283</fpage>
				<lpage>286</lpage>
				<pub-id pub-id-type="doi">10.15298/rusentj.26.3.12</pub-id>
			</mixed-citation>
		</ref>
	</ref-list>
    <app-group id="appg1">
      <app id="app1">
        <title>Supplementary material</title>
        <supplementary-material id="suppl1" content-type="data-supplement" mimetype="text" mime-subtype="html" xlink:href="https://doi.org/10.5281/zenodo.6353889" position="float" orientation="portrait">
          <p>Supplementary material containing additional images and tables with the original data are deposited on zenodo and can be accessed via the following link: <ext-link xlink:href="https://doi.org/10.5281/zenodo.6353889" ext-link-type="uri">https://doi.org/10.5281/zenodo.6353889</ext-link></p>
        </supplementary-material>
      </app>
    </app-group>
  </back>
</article>
