Dasydorylas setosus (Becker, 1908)

Material (MT: 2♂♂ 5♀♀; YT: 3♀♀). SPAIN, Canary Islands, La Palma, Caldera de Taburiente National Park: Playa del Rio Taburiente: 15.V.2000, 1♀ (MNCN_Ent 202044, YT), coll. MNCN; 30.V.2000, 1♂ (MT), coll. SMTD; 19.VI.2000, 1♀ (MNCN_Ent 202045, MT), coll. MNCN.— Barranco de las Traves: 5.VI.2000, 1♀ (MNCN_Ent 202042, YT), coll. MNCN; 19.VI.2000, 1♀ (YT), coll. SMTD; 27.VI.2000, 1♂ (MNCN_Ent 202043, MT), coll. MNCN.— Lomo de las Chozas: 1.VI.2000, 1♀ (MNCN_Ent 202047, MT), coll. MNCN.— Roque de la Cumbrecita: 1.VI.2000, 1♀ (MNCN_Ent 202041, MT), coll. MNCN; 21.VI.2000, 1♀ (MNCN_Ent 202046, MT), coll. MNCN.— Roque de los Muchachos: 20.VI.2001, 1♀ (MT), coll. SMTD.

Remarks. Dasydorylas setosus was originally described from specimens collected on Gran Canaria, La Palma and Tenerife, and was redescribed by Kehlmaier (2005). Its current distribution comprises Canary Islands (La Gomera, El Hierro, La Palma, Tenerife, Gran Canaria), mainland Spain, Madeira and Morocco. Here, the species was recorded from 15th May to 27th June. Literature records indicate that it can be found all year round on Canary Islands.

Tomosvaryella freidbergi De Meyer, 1995

Material (MT: 2♀♀). SPAIN, Canary Islands, La Palma, Caldera de Taburiente National Park: Roque de la Cumbrecita: 1.VI.2000, 1♀ (MNCN_Ent 202050, MT), coll. MNCN.— Roque de los Muchachos: 4.VII.2001, 1♀ (MT), coll. SMTD.

Remarks. Representing the first record for La Palma, T. freidbergi was previously recorded from Canary Islands (Fuerteventura, La Gomera, Tenerife) by De Meyer et al. (2001). For species recognition see De Meyer (1995) and Földvári & De Meyer (1999). Tomosvaryella freidbergi has been recorded from Canary Islands, mainland Portugal, mainland Spain, mainland France, Israel, Hungary, Egypt, Iran, Kazakhstan and Kyrgyz Republic. The material at hand was collected from 1st June to 4th July. Literature records for Canary Islands range from February to July and September.

Tomosvaryella parakuthyi De Meyer, 1995

Material (MT: 2♀♀; YT: 2♂♂). SPAIN, Canary Islands, La Palma, Caldera de Taburiente National Park: Barranco de las Traves: 19.VI.2000, 1♂ (MNCN_Ent 202048, YT), coll. MNCN.— Roque de los Muchachos: 31.V.2001, 1♀ (MNCN_Ent 202049, MT), coll. MNCN; 15.VII.2001, 1♀ (MT), coll. SMTD; 17.VII.2001, 1♂ (YT), coll. SMTD.

Remarks. First record for La Palma, yet previously cited from Gran Canaria by De Meyer et al. (2001). The present material has been recorded between 31st May and 17th July. The specimen from Gran Canaria was collected at the end of February. So far, T. parakuthyi is known from Canary Islands, Egypt, Iran and Israel.

Chalarus guanche Kehlmaier sp. nov.

Chalarus perplexus in De Meyer et al. (2001)

Chalarus sp. near zyginae in Kehlmaier & Assmann (2008)

http://zoobank.org/urn:lsid:zoobank.org:act:7FAE7CE3-4DCA-4425-81AF-EC870CDDBDEE

Figs. 1–3

Holotype. 13.VI.2000, ♂ (#29, YT), SPAIN, Canary Islands, La Palma, Caldera de Taburiente National Park, Barranco de las Traves, leg. T. Domingo-Quero, coll. MNCN (MNCN_Ent 160689).

Paratypes. SPAIN, Canary Islands, La Palma, Caldera de Taburiente National Park: Playa del Rio Taburiente: 6.III.2000, 1♀ (#25, MT).— Barranco de las Traves: 22.VIII.2000, 1♀ (#2, MNCN_Ent 160706, MT).— Lomo de las Chozas: 8.III.2000, 1♀ (#21, MNCN_Ent 160705, MT); 22.III.2000, 1♂ (#48, MNCN_Ent 160690, YT); 26.IV.2000, 1♀ (#15, MNCN_Ent 160702, MT); 21.VI.2000, 5♂♂ (#43–47¹, MT), 1♀ (#14, MNCN_Ent 160695, MT); 6.VII.2000, 2♀♀ (#19–20², MT); 19.VII.2000, 3♂♂ (#40–42³, MT); 4♀♀ (#10–13⁴, MT); 26.VII.2000, 1♀ (#17, MT); 16.VIII.2000, 2♂♂ (#38–39, MT); 6.IX.2000, 1♀ (#18, MT).— Roque de los Muchachos: 25.VIII.2000, 1♀ (#27, MNCN_Ent 160707, MT). Paratypes in coll. SMTD: #17, #18, #25, #38, #39, #42, #43. Others in coll. MNCN.

Non-type material. SPAIN, Canary Islands, La Palma, Caldera de Taburiente National Park: Playa del Rio Taburiente: 17.IV.2000, 1♂ (#55, MT), 1♀ (#23, MNCN_Ent 202027, MT); 15.V.2000, 1♀ (#22, MT); 19.VI.2000, 1♂ (#57, MNCN_Ent 202029, YT); 3.VIII.2000, 4♂♂ (#58–61⁵, YT), 1♀ (#24, MNCN_Ent 202034, YT); 7.VIII.2000, 1♀ (#26, MNCN_Ent 202028, MT); 18.X.1999, 1♂ (#56, MT).— Barranco de las Traves: 8.V.2000, 1♀ (#8, MT); 30.V.2000, 1♀ (#6, MNCN_Ent 160708, MT); 5.VI.2000, 1♂ (#35, MT); 13.VI.2000, 1♂ (#30, MNCN_Ent 202018, MT); 19.VI.2000, 1♀ (#1, MNCN_Ent 202019, MT); 27.VI.2000, 1♂ (#33, MNCN_Ent 202020, MT); 4.VII.2000, 1♂ (#34, MNCN_Ent 202021, MT); 10.VII.2000, 1♂ (#28, MNCN_Ent 202023, YT); 24.VII.2000, 1♂ (#32, YT), 1♀ (#3, MNCN_Ent 202022, MT); 3.VIII.2000, 2♀♀ (#4, MNCN_Ent 202024, #5, MNCN_Ent 202025, YT); 7.VIII.2000, 1♂ (#36, MT), 1♀ (#7, MT); 18.IX.2000, 1♂ (#31, MNCN_Ent 202026, YT).— Lomo de las Chozas: 5.I.2000, 1♂ (#51, MNCN_Ent 202035, MT); 26.IV.2000, 1♂ (#49, MT), 1♀ (#16, MT); 1.VI.2000, 1♂ (#37, MNCN_Ent 202036, MT), 1♀ (#9, MT); 6.VII.2000, 3♂♂ (#52–54⁶, MT); 26.VII.2000, 1♂ (#50, MNCN_Ent 202039, MT).— Roque de los Muchachos: 27.VII.2000, 1♂ (#62, MNCN_Ent 202040, YT). Specimens in coll. SMTD: #7, #8, #22, #32, #35, #36, #49, #54, #55, #56. Others in coll. MNCN.— SPAIN, Canary Islands, La Palma, south of Barlovento, laurisilva, 28°39’N 17°52’W, 800 m, 29.X.2002, 3♂♂ (DNA CK145, CK146, CK417), 1♀, leg. et coll. C. Kehlmaier.— PORTUGAL, Madeira, path between Boca de Encumeada and Boca dos Corgos, S of Ribeiro do Póco, 1 km W of Fenda do Ferreiro, moist steep slope, 1200–1250 m, 30.V.1987, 1♂ (M1, X572), leg. W. Barkemeyer, coll. SDEI.— PORTUGAL, Madeira, Fanal, laurel on pasture, 12.IX.1986, 3♂♂ (M2–M4, L1583), leg. P. Ohm, coll. SDEI.— PORTUGAL, Madeira, Pico Facho, near Machico, herbaceous vegetation, 300 m, 19.IX.1986, 1♂ (M5, L1578), leg. P. Ohm, coll. SDEI.

Note. The material at hand consists of 71 specimens. Sixty-two from the Caldera de Taburiente National Park (35♂♂, 24 MT, 11YT; 27♀♀, 24MT, 3YT)—unfortunately, specimens #9 and #16 were misplaced, and of specimens #37 and #49 only the genitalia remain—, three males and one female from Barlovento (NE La Palma), and five male specimens from three localities on Madeira. Only specimens attributed to clade A via ITS2 were included in the type series in order to prevent confusion if clade B or C might be considered as a distinct species one day.

Differential diagnosis. Chalarus guanche sp. nov. is part of the holosericeus species group as outlined in Kehlmaier & Assmann (2008, 2010). The taxonomic structure of this flock of closely allied taxa is still not satisfactorily resolved. Morphologically, females are closest to C. zyginae Jervis, 1992 being slightly larger in size and having their frons not as strongly narrowed (at narrowest point ~1.5 times largest frontal facet instead of 1.0), whereas males should be addressed as C. holosericeus agg. (aggregate species), as the genitalia of all taxa of this species group are virtually identical and cannot be used for species separation except in the case of C. zyginae. Because of the cryptic nature of this species, only the holotype is described in detail, whereas the observed variability of the females is characterised in Tables 2–3 and Figs 2–4.

Description of holotype. Male. Body length 1.9 mm. Head. Face black, silver-grey pollinose. Eyes separated, ommatidial facets slightly enlarged towards the front. Frons black, silver-grey pollinose in lower quarter. At its narrowest point, width of 2 accompanying ommatidial facets. Antenna dark brown. Pedicel with 2 short upper and 2 lower bristles, one of the latter longer than flagellum which is of an ovoid-kidney shape and is slightly longer than wide. Vertex black. Ocellar triangle with 1 pair of long and 2 pairs of short ocellar bristles. Occiput black, hardly visible in lateral view. Thorax. Entirely dark brown to black. Dorsal surface of prescutum and scutum covered with rather widely spaced black setae, as in other species of the genus, the longest ones towards the lateral and posterior margins (notopleural, supraalar and postalar bristles). Scutellum with 2 pairs of long black marginal bristles, dorsally with 2 pairs of short setae. Wing and halter. Length: 1.9 mm. LW:MWW=2.8. Wing surface with a weak brownish tinge and covered with microtrichia except near base. Pterostigma brown and incomplete (LS:LTC=0.8). LSC:LTC:LFC=6.8:5.5:1.0. Wing venation incomplete, as in other members of Chalarus. Halter dark brown with stem narrowly white. Leg. Entirely dark brown except tarsal segments slightly paler (mid brown). psr ~13 setae, mid brown; pvsr ~16 setae, light brown, apical one not extending beyond apex; aasr ~9 short setae, mid brown, apical ones extending as far as apex; pdsr ~8 dark brown setae, apical ones extending as far as apex. Pulvilli shorter than distitarsus. Abdomen. Gently ovate in dorsal view, LT35:WT2=1.1. Entirely dark brown. Setae mid to dark brown. Dorsally and ventrally sparse and short, long and dense along lateral margins. Terminalia as in other members of the holosericeus species group (Fig. 1; see also figures in Kehlmaier & Assmann, 2008): surstyli symmetrical, with pronounced medial protuberances, best seen in dorsal view; gonopods symmetrical, broadened in distal half; phallus with straight shaft; tip of distiphallus short and broad; Lmtdp:Ltdp slightly more than 3.0; phallic processes symmetrical, slightly shorter than membranous tip of distiphallus and parallel to the latter; all three ejaculatory ducts placed distally on membranous tip of distiphallus; ejaculatory apodeme parasol-shaped.

Female differs from male by the usual sexual dimorphisms. For morphometric measurements and ratios see Tables 2–3. Bristles of pedicel shorter; none longer than flagellum. Frontal facets moderately to greatly enlarged. Frons at narrowest point about diameter of largest frontal facet. Frons with pairs of fronto-orbital setae. Tergites 2–5 laterally with shorter setae. Ovipositor as in Figs. 2–3; one and a half to twice length of base and tergite 9 gently curved towards sternites. Base dark brown; piercer somewhat paler towards apex.

Etymology. The species is named after the native inhabitants of the Canary Islands. It is believed that the Guanches were of Berber origin (North West African) (Fregel et al., 2009) and migrated to the Canary Islands around 1,000 BC or perhaps earlier.

Distribution. The species has been recorded from La Palma (Canary Islands) and Madeira.

Morphological variability. The observed morphological variability in the material of Chalarus studied (Tables 2–3) raised the suspicion as to whether it actually contained several undescribed species. The degree of enlargement of the frontal ommatidial facets (DFF) varies by ~40% (0.035–0.05 mm). Wing length, used to assess the size of the fly, by ~50% (1.5–2.25 mm). And the length of tergite 9 by ~60% (0.15–0.24 mm). In the latter, one can also observe that the longer tergite 9 is, the stronger is its curvature (Figs. 2–3). When scoring length of tergite 9 against wing length, a positive correlation between these two morphological traits can be observed (Fig. 4). However, although the extrema clearly differ, there does not seem to exist a precise division.

Molecular analyses. The Internal Transcribed Spacer Region 2 (ITS2) is a nontranscribed fragment of the ribosomal DNA (rDNA). Being nested between the slow evolving 5.8S and 28S rDNA loci, ITS2 is renowned for its high evolutionary rate and has been successfully applied for species delimitation and phylogenetic studies in Pipunculidae and other taxa (Kehlmaier & Assmann, 2010). The aligned ITS2 dataset for the Chalarus exiguus species group is 352bp long and consists of 51 specimens representing six species. In this study, the fragment had approximately 370bp and was sequenced in mostly excellent quality for 41 specimens. The NJ analysis of the ITS2 dataset, divides C. guanche sp. nov. into three clades, with two present on La Palma (clade A & B) and a third one on Madeira (clade C) (Fig. 5). With 0.6%, the uncorrected pairwise genetic distance is identical between all three clades (Table 4). Each clade has a single private (apomorphic) mutation. In addition, clade A has a 3bp long indel (Fig. 6). The minimum interspecific genetic distance between the species of the exiguus group ranges from 1.1% to 3.8% (Table 4). The 41 specimens fall into 26 clade A, 11 clade B and 4 clade C.

In four specimens of clade A (#2, #17, #20, #21), a second fragment of about 220bp amplified with somewhat lower signal strength. This sequence is identical to ITS2 but exhibit a 151bp long deletion from alignment position 167 to 318, resulting in an interference of 75bp in the chromatograms around positions 170 to 240. This shorter sequence was disregarded in the analyses performed but might be an indication for intragenomic variation. An example of this shorter sequence was sent to ENA for specimen #20 (LT715963). Of clade B and C, all 15 sequences show a weak n-1 sequence from alignment position 263 onwards after a 11-fold adenine repeat. In clade A, the homologous section consists of a 8-fold adenine repeat and did not pose any sequencing problems. Although intragenomic variation cannot be ruled out here either, such artefacts may also result from a slippage of the enzyme during PCR amplification. For the present analyses, the low signal of the underlying n-1 sequence was disregarded. Interestingly, all C. guanche samples have an additional 20bp prior to the reverse primer (ACCTCAACTCATATGGGATT). In a previous study (Kehlmaier & Assmann, 2010), this motive emerged in only few samples of Chalarinae (FM212652, FM212653, FM212655, FM213119, LN879371), and, slightly modified, also in one Pipunculinae used as outgroup (FM212650). As this oligonucleotide has not been detected in representatives of the C. exiguus species group before and its origin is most likely attributed to intragenomic variation as well, it has been excluded from the present analyses, yet included in ENA submissions.

The 5’ end of the mitochondrial cytochrome oxidase subunit I (COI) is the classical DNA barcoding fragment sequenced for a multitude of taxa (Hebert et al., 2003). The aligned COI dataset for the Chalarus exiguus species group is 658bp long and consists of 40 specimens representing six species. Thirty specimens from La Palma (24 clade A and 6 clade B) and five from Madeira (all clade C) yielded a DNA barcode with moderately to very good sequence quality. The observed genetic divergence (p-distance) between the individual clades ranges from 1.2–3.1% between clades A and B, 1.2–1.8% between clades A and C, and 0.6–1.8% between clades B and C. The maximum intraspecific variability is 0.8% in clade A, 1.2% in clade B, and 0% in clade C. The minimum interspecific genetic distance between the species of the exiguus group ranges from 2.6% (C. guanche sp. nov. to C. griseus and C. saxonicus respectively) to 6.8% (C. exiguus to C. holosericeus) (Table 5). Interestingly, two specimens (#10, #21) with a clade A ITS2 genotype cluster with the specimens that have a clade B ITS2 genotype, providing evidence for hybridisation between both clades (Fig. 7).